ID: 1126163497

View in Genome Browser
Species Human (GRCh38)
Location 15:45634873-45634895
Sequence CCAGGGCGTTGAGCGCTCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163497_1126163502 -5 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 0
3: 16
4: 138
1126163497_1126163514 29 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163514 15:45634925-45634947 CGGCGCCGGGCGGGGCACGGCGG 0: 1
1: 0
2: 7
3: 118
4: 924
1126163497_1126163512 21 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163512 15:45634917-45634939 CTGGGCTGCGGCGCCGGGCGGGG 0: 1
1: 0
2: 3
3: 64
4: 508
1126163497_1126163503 2 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163503 15:45634898-45634920 TGTTCACTGACCATGGTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 148
1126163497_1126163511 20 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163511 15:45634916-45634938 CCTGGGCTGCGGCGCCGGGCGGG 0: 1
1: 1
2: 6
3: 50
4: 536
1126163497_1126163505 9 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG 0: 1
1: 0
2: 6
3: 40
4: 382
1126163497_1126163504 3 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163504 15:45634899-45634921 GTTCACTGACCATGGTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
1126163497_1126163509 19 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG 0: 1
1: 0
2: 2
3: 54
4: 491
1126163497_1126163513 26 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163513 15:45634922-45634944 CTGCGGCGCCGGGCGGGGCACGG 0: 1
1: 0
2: 4
3: 67
4: 560
1126163497_1126163515 30 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163515 15:45634926-45634948 GGCGCCGGGCGGGGCACGGCGGG 0: 1
1: 0
2: 12
3: 137
4: 1078
1126163497_1126163507 15 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 20
4: 297
1126163497_1126163508 16 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163508 15:45634912-45634934 GGTGCCTGGGCTGCGGCGCCGGG 0: 1
1: 0
2: 5
3: 28
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163497 Original CRISPR CCAGGGCGTTGAGCGCTCAC GGG (reversed) Exonic
900008203 1:79542-79564 TCAGGGGGTTTAGGGCTCACTGG - Intergenic
901984465 1:13063283-13063305 GCAGGGCGTTGGTGGCTCACTGG - Intronic
901997345 1:13163487-13163509 GCAGGGCGTTGGTGGCTCACTGG + Intergenic
902143856 1:14379860-14379882 CCAGGGCCTTGAGCAAACACAGG + Intergenic
902448430 1:16482386-16482408 CCAGGGAGGTGAGGGCTCAGAGG + Intergenic
902448670 1:16483679-16483701 CCAGGGAGGTGAGGGCTCAGAGG - Intergenic
902506109 1:16939681-16939703 CCAGGGAGGTGAGGGCTCAGAGG + Intronic
902506353 1:16940951-16940973 CCAGGGAGGTGAGGGCTCAGAGG - Intronic
903141032 1:21339309-21339331 CAGAGGCGTTGAGAGCTCACTGG - Intronic
903155093 1:21437349-21437371 CCAGGGAGGTGAGGGCTCAGAGG + Intergenic
910209342 1:84777489-84777511 CCGGGGTGTTTAGCACTCACTGG + Intergenic
911487250 1:98516894-98516916 CCAGGGCCTTGAGCGAATACAGG + Intergenic
920549688 1:206847747-206847769 CCAGGGCCTTGAGCAAACACAGG + Intergenic
1063421835 10:5918418-5918440 ACAGGGCGTTGACCGCACCCCGG - Exonic
1070915129 10:80148586-80148608 CCAGGGCCTTGAGCAGACACAGG + Intergenic
1071209246 10:83318287-83318309 CCAGGGCGTTGAGCAAACATAGG + Intergenic
1072083695 10:92057586-92057608 CCAGGGCCCTGAGCGAACACAGG + Intronic
1073052900 10:100680904-100680926 CCAGGGTGCTGAACGCGCACGGG - Intergenic
1075040678 10:119104504-119104526 CCGGGACGTCGAGCGCTCCCAGG + Intronic
1076589679 10:131574564-131574586 CCAGGGCGCTGAGGACTCAGCGG + Intergenic
1079625912 11:22617792-22617814 CCAGGGCATTGAGCAAACACAGG - Intergenic
1081792364 11:45797263-45797285 CCAGTGCTTAGAGAGCTCACAGG + Intergenic
1082160000 11:48880317-48880339 CCAGGGCGTGGAGAGCGTACTGG + Intergenic
1084621225 11:70271179-70271201 CCAGGGCTTTCAGCGGCCACAGG - Intronic
1085475491 11:76786294-76786316 CAAGGGCCATGGGCGCTCACAGG + Intronic
1087877034 11:103370458-103370480 CCAGGGCCTTGAGTGATCATAGG + Intronic
1088611636 11:111583094-111583116 CCAGGGCTTTGAGTACACACCGG - Intergenic
1091312244 11:134582901-134582923 ACAGGGCTGTGAGTGCTCACTGG - Intergenic
1094658103 12:32440679-32440701 CCAGGGCCTTGAGCGAACATAGG - Intronic
1096777957 12:53975092-53975114 CCAGCCCGCTGAGCGCTCAGCGG - Intronic
1101887451 12:108678241-108678263 CCAGGGTGTTGTGTGCACACAGG - Intronic
1113832260 13:113305288-113305310 CCTGGGTGGTGAGTGCTCACTGG + Intronic
1113886127 13:113659139-113659161 CCAGGACGTGGAGGGCTCCCAGG + Intergenic
1124552712 15:30696390-30696412 CCAGGGGCATGAGCACTCACAGG - Intronic
1124678530 15:31709280-31709302 CCAGGGGCATGAGCACTCACAGG + Intronic
1126163497 15:45634873-45634895 CCAGGGCGTTGAGCGCTCACGGG - Exonic
1127293640 15:57591754-57591776 CCAGGGCGCTGCGCCCTCCCAGG - Intergenic
1128800297 15:70492834-70492856 CCAGGGGGTTGTGCTCTCAGTGG - Intergenic
1129584510 15:76849119-76849141 GCAGGGAGTTGAAGGCTCACAGG - Intronic
1131632709 15:94196087-94196109 CCATGGTGTAGAGCGCGCACTGG - Intergenic
1132445351 15:101912568-101912590 TCAGGGGGTTTAGGGCTCACTGG + Intergenic
1142806688 17:2375191-2375213 CCAGGGGGCTGAACGCTCAATGG - Intronic
1152340605 17:79721948-79721970 CCAGGGCATCGAGGGCTCCCTGG + Intergenic
1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG + Intronic
1154386675 18:13898510-13898532 CCAGGGCCTTGAGTGAACACAGG + Intronic
1158045733 18:53153473-53153495 CCAGGGTGTGGCGCTCTCACAGG - Intronic
1160427802 18:78790327-78790349 CCAGGGCGTTGGGAGCTCCAGGG + Intergenic
1160639958 19:121139-121161 TCAGGGGGTTTAGGGCTCACTGG - Intergenic
1161957780 19:7506158-7506180 CACGGGCGGTGAGCGCTCCCGGG + Exonic
1162158684 19:8696659-8696681 CCAGGGGTTGGAGCACTCACGGG + Intergenic
1165097377 19:33417000-33417022 CCAGCCCGTGGAGCGCTCCCGGG + Intronic
1168209696 19:54881508-54881530 GCAGGGGGTTGAGGGCTCACAGG + Intronic
925646916 2:6045077-6045099 GCAGGGGGTTGAGGGCTCACTGG - Intergenic
930159313 2:48138014-48138036 CCAGGGCCTTGAGCAAACACAGG + Intergenic
930492411 2:52092711-52092733 CCAGGGCCTTGAGCAAACACAGG - Intergenic
943309800 2:186311244-186311266 CCAGGGCCTTGAGAGAACACAGG + Intergenic
1169227023 20:3863337-3863359 CCAGGGCACTGAGGGCTGACTGG - Intronic
1184680609 22:46070769-46070791 CCAGGGCGGAGCGCGCGCACGGG - Intronic
950262975 3:11555315-11555337 CCAGGGTGCAGTGCGCTCACGGG - Exonic
950655514 3:14433930-14433952 CAAAAGCGTTGAGCCCTCACTGG + Intronic
951613839 3:24521408-24521430 CCAGGCCAGCGAGCGCTCACCGG + Intergenic
952222054 3:31332736-31332758 CCAGGGCCTTGAGCGAACATAGG + Intergenic
959761864 3:109976023-109976045 CCAGGGCCTTGAGTGAACACAGG - Intergenic
966452152 3:180074556-180074578 CCAGGGCCTTGAGCAAACACAGG + Intergenic
968640698 4:1713000-1713022 CCTGGCCGTTGACCGCACACCGG + Intergenic
969288802 4:6225551-6225573 CCAGGGCCTTGGGAGCTCTCCGG + Intergenic
969669445 4:8581683-8581705 CCAGGGACTTGGGCGCTCCCTGG + Intronic
974109571 4:57511043-57511065 GCAGGGGGTTGAGGGCTCACTGG + Intergenic
978529932 4:109703048-109703070 CCGGGGCGATGAGCGCTTTCGGG - Intronic
994530054 5:100957333-100957355 CCAGGGCCTTGAGGGAACACAGG + Intergenic
996133309 5:119808947-119808969 CCAGGGCCTTAAGCGAACACAGG - Intergenic
1000399566 5:160811831-160811853 CCAGGGCCTTGAGCGCACATAGG + Intronic
1002747308 6:69546-69568 TCAGGGGGTTTAGGGCTCACTGG - Intergenic
1002896444 6:1382909-1382931 CCAAGGCGCTGAGAGCCCACGGG - Intergenic
1006013005 6:31057909-31057931 CCAGGGCCTTGAACACTCCCAGG - Intergenic
1006305374 6:33215336-33215358 CCAGGGTGTTGAGGGCTGCCAGG - Intergenic
1007115614 6:39341132-39341154 CCAGGGGGTTGAGCAGTGACAGG - Intronic
1013925539 6:115467799-115467821 CCAGGGCCTTGAGCAATCAGAGG - Intergenic
1018612945 6:165661812-165661834 CCCGGGCGTGGAGCGCCCAGGGG - Intronic
1018824256 6:167397445-167397467 CCAAGGCCCTGAGTGCTCACAGG - Intergenic
1019518253 7:1448979-1449001 ACGGGGCCTTGAGCGCCCACCGG - Intronic
1019621474 7:1994519-1994541 GCAGGGCAGTGAGCGCCCACCGG + Intronic
1022080298 7:27013183-27013205 CCAGGGCCTTGAGCAAACACAGG + Intergenic
1024410931 7:49039835-49039857 CCAGGGCCTTGAGTGAACACAGG + Intergenic
1024498412 7:50072489-50072511 CCAGGGCCTTGAGCAAACACAGG + Intronic
1030639080 7:111984085-111984107 CCTGGGCGTTGAGGGCCCACTGG + Intronic
1033489142 7:141824643-141824665 CCAGGGCTTTGAGCGAACAAAGG - Intergenic
1034937979 7:155211959-155211981 CCAGGGCAGTGAGGGCTCATGGG + Intergenic
1049345364 8:142135882-142135904 CCAGGGCGGGTAGTGCTCACGGG - Intergenic
1051990999 9:23152981-23153003 CCAGGGACTTGAGTGATCACAGG - Intergenic
1055227445 9:74015847-74015869 CCAGGGCCTTGAGCAGACACCGG + Intergenic
1057900151 9:98942440-98942462 CCTGGGCGGTGAGGGCTCAGAGG - Intergenic
1060539518 9:124420111-124420133 CCAGGATGTTGAGTGCTCTCAGG - Intergenic
1188210717 X:27419934-27419956 CCAGGGCCTTGAGTGAACACAGG + Intergenic
1189988694 X:46575194-46575216 CCCGGGCGTCGCGCGCTGACAGG - Exonic
1191059250 X:56277661-56277683 CCAGGGCCTTGAGTGAACACTGG - Intronic
1194218824 X:91167032-91167054 CCAGGGCCTTGAGCGAACATAGG - Intergenic
1194787538 X:98105819-98105841 CCAGGGCTTTGAGCAATCATAGG - Intergenic
1197052486 X:122076909-122076931 CCAGGGCCTTGAGTGAACACAGG - Intergenic
1199050668 X:143232916-143232938 CCAGGGCCTTGAGCAAACACAGG + Intergenic
1200402584 X:156028076-156028098 CCAGGCCTTTGAGAGGTCACAGG - Intergenic
1200555333 Y:4630786-4630808 CCAGGGCCTTGAGCGAACATAGG - Intergenic