ID: 1126163499

View in Genome Browser
Species Human (GRCh38)
Location 15:45634874-45634896
Sequence ACCAGGGCGTTGAGCGCTCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 47}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163499_1126163512 20 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163512 15:45634917-45634939 CTGGGCTGCGGCGCCGGGCGGGG 0: 1
1: 0
2: 3
3: 64
4: 508
1126163499_1126163511 19 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163511 15:45634916-45634938 CCTGGGCTGCGGCGCCGGGCGGG 0: 1
1: 1
2: 6
3: 50
4: 536
1126163499_1126163504 2 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163504 15:45634899-45634921 GTTCACTGACCATGGTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
1126163499_1126163508 15 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163508 15:45634912-45634934 GGTGCCTGGGCTGCGGCGCCGGG 0: 1
1: 0
2: 5
3: 28
4: 349
1126163499_1126163502 -6 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 0
3: 16
4: 138
1126163499_1126163513 25 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163513 15:45634922-45634944 CTGCGGCGCCGGGCGGGGCACGG 0: 1
1: 0
2: 4
3: 67
4: 560
1126163499_1126163509 18 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG 0: 1
1: 0
2: 2
3: 54
4: 491
1126163499_1126163515 29 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163515 15:45634926-45634948 GGCGCCGGGCGGGGCACGGCGGG 0: 1
1: 0
2: 12
3: 137
4: 1078
1126163499_1126163514 28 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163514 15:45634925-45634947 CGGCGCCGGGCGGGGCACGGCGG 0: 1
1: 0
2: 7
3: 118
4: 924
1126163499_1126163505 8 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG 0: 1
1: 0
2: 6
3: 40
4: 382
1126163499_1126163503 1 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163503 15:45634898-45634920 TGTTCACTGACCATGGTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 148
1126163499_1126163507 14 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 20
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163499 Original CRISPR ACCAGGGCGTTGAGCGCTCA CGG (reversed) Exonic
915320137 1:155051841-155051863 GCCAGGGCGCTGAGCGGGCATGG + Intronic
1067221622 10:44348106-44348128 TCCAGGGCATGGAGCTCTCAGGG - Intergenic
1069770096 10:70893187-70893209 ACCAGGGAGGTGAGCTCACAGGG + Intergenic
1073140916 10:101247072-101247094 AGCAGGGAGTTGAAAGCTCATGG + Intergenic
1077246809 11:1543733-1543755 ACCTGGGCAGAGAGCGCTCAGGG + Intergenic
1092449790 12:8591412-8591434 ACCACGGACTTGAGCGCTCGAGG + Intergenic
1098577803 12:72063530-72063552 ACCAGGACATTGAGGGCACAAGG + Intronic
1102914357 12:116741899-116741921 CCCAGGGCTTTGAGAGATCAAGG - Intronic
1106320606 13:28634409-28634431 ACCAGGGTATTGAGAGCTGAGGG - Intergenic
1113836465 13:113331311-113331333 ACCTGGGGGTTGGGGGCTCAGGG + Intronic
1118815988 14:69314372-69314394 GCCAGGGCTTTGAACTCTCATGG - Intronic
1118987167 14:70766424-70766446 ACCATAGGGTTCAGCGCTCAAGG + Intronic
1120161710 14:81152800-81152822 ACCATGGCATTGATTGCTCAGGG - Intergenic
1124441586 15:29689561-29689583 ACCAGGCCCTTCAGGGCTCATGG + Intergenic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1132346845 15:101113780-101113802 CCCAGGGAGTTGAGACCTCAGGG - Intergenic
1134047009 16:11108410-11108432 ACCAGGGAGTTAAACCCTCAGGG + Intronic
1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG + Intergenic
1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG + Intronic
1160427800 18:78790326-78790348 CCCAGGGCGTTGGGAGCTCCAGG + Intergenic
925916674 2:8611921-8611943 ACAAGGGCTTTCAGCGTTCAAGG - Intergenic
942994161 2:182240953-182240975 ACCACGGGGTGGAGCTCTCATGG + Intronic
946439278 2:219681384-219681406 ACCAGGGCCTTGAGCAAGCAGGG + Intergenic
1169248750 20:4044594-4044616 ACCAGGGTGCTGAGGACTCAGGG - Intergenic
1181028028 22:20136942-20136964 ACCAGGGCCCAGAGCTCTCAGGG - Intronic
954904386 3:54047444-54047466 ATCAGGGAGTTGAGCACCCACGG - Intergenic
963301108 3:143598052-143598074 ACCAGGGACTGGAGAGCTCAGGG - Intronic
985081384 4:186268326-186268348 ATCAGGGACTTGAGCGTTCATGG + Intronic
985494307 5:196065-196087 ACCAGGGCGGTCAGCGCTGCGGG + Intergenic
990977027 5:61569350-61569372 CCCAGAGTGCTGAGCGCTCAGGG - Intergenic
993940549 5:94052818-94052840 ACCAGGGAGTTGAACGCTCAAGG + Intronic
999415266 5:151389563-151389585 ACCAGGGTGTTGAGGGGTCGGGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1009723773 6:67509637-67509659 CCCAGGGCTTTGAGAGGTCAAGG + Intergenic
1012086780 6:94836730-94836752 ACCAGGGACTTGAGCATTCATGG - Intergenic
1015127408 6:129770159-129770181 ACCAAGGCTTTGAGAGCCCAAGG + Intergenic
1018612947 6:165661813-165661835 GCCCGGGCGTGGAGCGCCCAGGG - Intronic
1019518251 7:1448973-1448995 ACCAGGCCGGTGGGCGCTCAAGG + Intronic
1019575220 7:1734528-1734550 ACCAGAGCGGGGAGGGCTCAGGG - Intronic
1029553039 7:101248305-101248327 ACCAGGGGTTTGAGAGCTGAAGG - Intronic
1034937977 7:155211958-155211980 GCCAGGGCAGTGAGGGCTCATGG + Intergenic
1039911131 8:41828080-41828102 CCCAGGGCCGCGAGCGCTCAGGG + Intronic
1049223901 8:141440639-141440661 ACCTGGGGGTAGAGCGCCCATGG + Intergenic
1049547538 8:143240508-143240530 ACCAGGGCGATGGGCTCTCCAGG + Intergenic
1060223112 9:121774734-121774756 ACCTGGGGGTTGAGGGCTGAGGG + Intronic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1186515761 X:10165208-10165230 ACGAGGGGGCTGAGTGCTCAGGG - Intronic
1186541800 X:10408847-10408869 ACCAGGGTGCTGAGGGCTGACGG - Intergenic
1194285600 X:92007118-92007140 ACCAGGGCCTTGAGCAAACATGG - Intronic
1199750890 X:150816412-150816434 ACCAAGGCTTGGAGCCCTCAAGG - Intronic