ID: 1126163502

View in Genome Browser
Species Human (GRCh38)
Location 15:45634891-45634913
Sequence CCTGGTGTGTTCACTGACCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163495_1126163502 8 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 0
3: 16
4: 138
1126163496_1126163502 -4 Left 1126163496 15:45634872-45634894 CCCCGTGAGCGCTCAACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 0
3: 16
4: 138
1126163497_1126163502 -5 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 0
3: 16
4: 138
1126163499_1126163502 -6 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 0
3: 16
4: 138
1126163494_1126163502 25 Left 1126163494 15:45634843-45634865 CCGGATGGACGCTTGTTCCTGGT 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 0
3: 16
4: 138
1126163492_1126163502 30 Left 1126163492 15:45634838-45634860 CCAGGCCGGATGGACGCTTGTTC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 0
3: 16
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163502 Original CRISPR CCTGGTGTGTTCACTGACCA TGG Exonic
900728211 1:4232697-4232719 CTTGCTTTGTTCACTGAACATGG - Intergenic
901179795 1:7333725-7333747 CCTGGTGTATTTACATACCACGG + Intronic
903751314 1:25622742-25622764 CCTGCTGTGTTCAACCACCAGGG + Intronic
903767352 1:25743366-25743388 CATGGTCTGTTTACTGAACAGGG + Intronic
904367644 1:30024980-30025002 CCTGGTGTGGTCACTGTCAGGGG - Intergenic
904680285 1:32224240-32224262 CCTGGTCTCTTCACTGACTGAGG + Intronic
912221822 1:107686499-107686521 CCAGGTGTGTTCACTCTCCAAGG - Intronic
912746011 1:112246040-112246062 CCTGGTGTGGTCTCACACCAGGG + Intergenic
915763931 1:158343837-158343859 CCTGGTTTGTTGACGGTCCAGGG + Intergenic
917506291 1:175630001-175630023 TCTGGTGTGTCCTCTGCCCAGGG + Intronic
917844159 1:179006459-179006481 CATAGTGTGTTCACTCACCAAGG + Intergenic
1062768533 10:82756-82778 CCAGGTGTGTGCAGAGACCACGG - Intergenic
1063200143 10:3779930-3779952 TCTGGTGTGCTCATTGTCCATGG - Intronic
1066095434 10:32067684-32067706 CCTCATGTCTTCAATGACCAAGG + Intergenic
1066388121 10:34957766-34957788 CCTGGTGTGGTCAGGGACCCAGG - Intergenic
1069964137 10:72099864-72099886 CCTTGTGTGCTCACTGAGCAGGG + Intronic
1070834063 10:79436894-79436916 CCTGCTGGGGTCACTGACCTAGG - Intronic
1075301677 10:121330250-121330272 CATGTTGTGCTCAATGACCAGGG + Intergenic
1077382332 11:2249970-2249992 CATGATGTGTTGTCTGACCAGGG - Intergenic
1083698505 11:64458276-64458298 CCTGTTCTGGTCATTGACCAGGG - Intergenic
1085452034 11:76639956-76639978 CCATGTGTGTTGACTGACCAAGG - Intergenic
1085731812 11:79006471-79006493 CCTTGTGTGATACCTGACCAAGG - Intronic
1086974237 11:93114446-93114468 CCTGATGTGTTCACCAACCCGGG + Intergenic
1101364237 12:104056786-104056808 TGTGCTGTGGTCACTGACCATGG - Intronic
1102329464 12:112016422-112016444 CCTGCTGTGTTCACTTAGTATGG + Intronic
1104037947 12:125111173-125111195 CGGGGTGTGTTCACAGACTAAGG + Intronic
1108470504 13:50762431-50762453 CCTGCTGTGCTCACGGAACAGGG + Intronic
1109908082 13:68872194-68872216 GCTGGTGTGTTACCTGACCCAGG + Intergenic
1113825904 13:113252821-113252843 CCTGGTATGTACAGAGACCACGG + Intronic
1114295429 14:21324972-21324994 AGTGCTGTGTTCACTGGCCATGG - Exonic
1114493874 14:23119440-23119462 CCTGGCTTGGTCCCTGACCAAGG - Exonic
1116153364 14:41170555-41170577 CAGGGTATGTACACTGACCATGG - Intergenic
1116346732 14:43803358-43803380 CCCTGTGTGTTCAGTTACCAGGG - Intergenic
1118686032 14:68292079-68292101 CCGGCTGGGTTCACTGGCCAGGG - Intronic
1118769749 14:68934478-68934500 GCTGGTGGGTTCAATGACAAAGG + Intronic
1119593950 14:75916577-75916599 CCTGGTGTGATCATGGATCATGG - Intronic
1123196265 14:106619335-106619357 CATGGTGTGGACACTGATCAAGG + Intergenic
1125115609 15:36087627-36087649 CCTGATGTGATCACTGTGCATGG + Intergenic
1126163502 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG + Exonic
1128769632 15:70272226-70272248 CCTGGTGTGTTCACTCCCCCAGG - Intergenic
1131666585 15:94577426-94577448 TCAGGTGTGTTCACCGAACAAGG + Intergenic
1135592553 16:23714667-23714689 CTTGGTGTCTTCAATGTCCAAGG + Intergenic
1137385488 16:48038729-48038751 CCTGGTCTGTCCACAAACCATGG - Intergenic
1137712317 16:50574860-50574882 ACTTGGGTGTTCACAGACCATGG - Intronic
1139300062 16:65937402-65937424 CCTGGTGTGTTCATTTTCTAGGG + Intergenic
1142549539 17:730017-730039 TCTGGTGACTTCACTGAGCATGG + Intergenic
1144888794 17:18481786-18481808 CCAGGTGTGTACACTGAGCTAGG + Intronic
1145143413 17:20462512-20462534 CCAGGTGTGTACACTGAGCTAGG - Intronic
1145792428 17:27636115-27636137 CCAGGTGTGTACACTGAGCTAGG + Intronic
1145807313 17:27743988-27744010 CCAGGTGTGTACACTGAGCTAGG + Intergenic
1149095209 17:52831763-52831785 CCTGTTGTATTCACTTGCCAGGG - Intergenic
1150322986 17:64232159-64232181 CCTGTTGTGTTCATTTACCTAGG - Intronic
1152784251 17:82239819-82239841 CGTGGTGTGGTCAGTGCCCAGGG + Exonic
1152961419 18:82589-82611 CCAGGTGTGTGCAGAGACCACGG - Intergenic
1153339684 18:3961168-3961190 CCTGAGGAGTTCACTGAGCAAGG + Intronic
1154311458 18:13269992-13270014 CCTGGTGTGTTTGCAGATCAAGG - Intronic
1154331112 18:13429709-13429731 CTTGGAGGGTTCACTGAACAAGG - Intronic
1157124129 18:44938716-44938738 CCTGGTGTTTTCCCTAACCTGGG - Intronic
1160732113 19:646011-646033 CCTGGTGTCTTCCCTGCCCCAGG - Intergenic
1162480289 19:10923561-10923583 CCTGGTGTCCTCACGGACCACGG + Exonic
1163581033 19:18138863-18138885 CCTGGTGTGTTTAAGGACCACGG - Intronic
1164663701 19:30006014-30006036 CCTAATTTGTTCTCTGACCATGG + Intronic
926469133 2:13231313-13231335 CCTGGTGTTTTCTCTATCCAAGG - Intergenic
927974305 2:27326568-27326590 CCTGGCATGATCACTGTCCAGGG + Exonic
930829735 2:55730248-55730270 CTTGGTGTGTGCACTGAGAAAGG - Intergenic
932712734 2:74079951-74079973 CCAGATGTGTTTACTGTCCAGGG + Intronic
933503172 2:83142491-83142513 CCTCATGTATTCACTGCCCAAGG - Intergenic
935759355 2:106304999-106305021 CCATGTCTGCTCACTGACCAAGG - Intergenic
937953592 2:127407033-127407055 CATGGTGTGTTTATTGCCCATGG + Intergenic
939173224 2:138720357-138720379 ACAGCAGTGTTCACTGACCAGGG + Intronic
940159728 2:150698319-150698341 CCTTGCGTCTTCACTGTCCAGGG + Intergenic
940890548 2:159031322-159031344 CCTGTTGTTTTCAGTGTCCATGG - Intronic
941657240 2:168157251-168157273 CCTGGGTTTTTCACTGTCCAAGG - Intronic
942026272 2:171913628-171913650 CCTGCTATGTTCATTCACCAAGG - Intronic
943752296 2:191522661-191522683 CCTGGTGAGGTCCATGACCAGGG + Intergenic
944991420 2:205241180-205241202 CCTGGTGTGTTCTCTGATTCAGG - Intronic
947984427 2:234436720-234436742 CCAAGTGTGTGCACTGACCTGGG - Intergenic
948200686 2:236127983-236128005 CCTGGTGTGTGCACTGGCTTCGG - Exonic
948450474 2:238067406-238067428 CCTGGTGTGTACACTAAGAATGG + Intronic
1170486447 20:16821328-16821350 CTTGGTCAGTTCACTGATCAAGG + Intergenic
1171373539 20:24676591-24676613 CCTGGCCTGGTCACTGGCCAGGG - Intergenic
1172506056 20:35463533-35463555 CCAGCTGTGTTCATTGCCCAGGG + Intronic
1172691926 20:36796171-36796193 CCTGGTGTGTTCAGTGATTCAGG - Intronic
1173916824 20:46714225-46714247 CCGGGTGTGTTTGCTCACCAGGG - Intronic
1175168847 20:57065634-57065656 CCTGGGCTGTTGAGTGACCATGG + Intergenic
1175661364 20:60815861-60815883 CCAGGTGTGTTCACAGAGCATGG - Intergenic
1175991584 20:62792557-62792579 GCTTGTATGTTCACTGACCATGG + Intergenic
1176597496 21:8760454-8760476 CCTGGTGCGTTGACTGAGCCTGG + Intergenic
1179560705 21:42214463-42214485 CCTGTTGGCTTCTCTGACCAAGG - Intronic
1181330297 22:22085918-22085940 CCTGGTGTCTCCCGTGACCAGGG + Intergenic
1181393886 22:22604397-22604419 TCTGGGGTGTTCACTGAGCTCGG - Intergenic
952991290 3:38833100-38833122 TCTGGTGTGTCCACTGCTCATGG - Intergenic
955087894 3:55720719-55720741 CATGACTTGTTCACTGACCAAGG - Intronic
956283386 3:67583135-67583157 CTTGGTATGTTCAATCACCAAGG + Intronic
966767644 3:183477833-183477855 CCTGCTGGATTCACTGGCCATGG - Intergenic
969316038 4:6381776-6381798 CCTGGAGTCTTCAATGCCCAGGG + Exonic
969536414 4:7758689-7758711 CCCGGTGTCTTCACTGCCCTTGG - Intergenic
975798624 4:78035476-78035498 ACTGGTGTGGCCAATGACCAAGG - Intergenic
978855540 4:113389968-113389990 CATGGTGTGCTCACTGATGATGG + Intergenic
979297340 4:119048725-119048747 CCTGGTGTGTTCAAGGTTCAAGG + Intronic
979573541 4:122258701-122258723 CATTGTGTGTTCACTGACTGTGG - Exonic
984447416 4:179854471-179854493 CCTTGTTTTTTCACTCACCATGG - Intergenic
988837558 5:35048008-35048030 CCTGGAGTGGTGACTGCCCATGG + Exonic
991385122 5:66079053-66079075 GCTGGTGGGTTCACTTTCCAAGG + Intronic
996217929 5:120891813-120891835 GATGGTGTGTTCACTGGCCCAGG - Intergenic
999397788 5:151241252-151241274 CCTGGTGTGTAACCTGAGCATGG + Intronic
1000116845 5:158161577-158161599 TCAGTTGTGGTCACTGACCAAGG + Intergenic
1001321337 5:170684702-170684724 CCTTGTGTGGCCAGTGACCAGGG - Intronic
1002786576 6:404958-404980 CCTGGTGTGTTCGGTGATGAGGG + Intronic
1008610194 6:53178393-53178415 CCTGTTCAGGTCACTGACCAAGG + Intergenic
1011535353 6:88370538-88370560 CCTACTGTGTTCATTGTCCATGG + Intergenic
1012772932 6:103463096-103463118 CCTTCTGTGCTCACTGACAAAGG + Intergenic
1013193508 6:107824894-107824916 CCAGGTGTGTGCACACACCATGG + Intergenic
1016910310 6:149192486-149192508 CCTGGAGTGTTCACTTCCGATGG + Intergenic
1017741010 6:157406758-157406780 CGCGGTTTGTTCACTGAACAAGG - Intronic
1019019558 6:168906631-168906653 CCTGTTGAGGTCACCGACCATGG - Intergenic
1019518769 7:1451255-1451277 CTTGGTGTGTTTTCTGCCCAGGG - Intronic
1019940146 7:4283050-4283072 CCTGGTGTGTCCAGTGACTCAGG - Intergenic
1026579624 7:71603588-71603610 CCTGGTGTATGCACTTAGCATGG - Intronic
1028645808 7:93095432-93095454 CATGGTATGTAAACTGACCAAGG - Intergenic
1031620035 7:123924669-123924691 TCTGGTGAGTTCACTGGGCAAGG - Intergenic
1033543155 7:142375885-142375907 CCTTTTGTTTTCACTGGCCAAGG + Intergenic
1033968589 7:147009968-147009990 CCTGGTGTGTTCAATGATACTGG - Intronic
1035565309 8:637051-637073 CCTGGTGTGGTCACTGCACAAGG - Intronic
1035977064 8:4324435-4324457 TTTGCTGTGTTCACTGACAAAGG - Intronic
1037645123 8:20786209-20786231 CCTGGACTGTTCACTGATGATGG - Intergenic
1038436841 8:27542217-27542239 CCTGGTCTGTTTACACACCATGG - Intronic
1039797989 8:40931722-40931744 CCTGGTGTGTTCAGAGAGCATGG - Intergenic
1045036585 8:98180910-98180932 CCCGGTGTGTTCAGTGAACAGGG + Intergenic
1048966062 8:139615482-139615504 CCTGCTGTGGTCTCTGGCCAAGG - Intronic
1049222883 8:141435895-141435917 CCTGGGGTGGGCACTGACCGTGG + Intergenic
1049274380 8:141712346-141712368 CCTTGTGTGTTCCCTGAAAAAGG - Intergenic
1050069540 9:1795950-1795972 CCTGGTGATACCACTGACCATGG + Intergenic
1054816086 9:69476900-69476922 CCTTCTGTGTACACTGACCTGGG - Intronic
1055954436 9:81760999-81761021 CCTGGTGTGTTCCAGGAGCAAGG - Intergenic
1056077951 9:83060918-83060940 CCTGGTTTGTACACTGACCCAGG + Intronic
1056266715 9:84904161-84904183 CATGGTGTGTCCTCTGCCCAAGG - Intronic
1056940058 9:90947580-90947602 CCTGGTGTCTTCAATGACTAGGG - Intergenic
1057253804 9:93526570-93526592 CTTGGTGGGTTCACAGAACAGGG - Intronic
1059790610 9:117637961-117637983 CCTGGTGTGTTGAGTGACCTTGG + Intergenic
1060212768 9:121720611-121720633 CAGGGTGTGCTCACTGCCCAGGG - Intronic
1060801085 9:126546251-126546273 CCTGGAGCGTTCACTGGCCATGG - Intergenic
1061072040 9:128316791-128316813 CCAGGGGTATTCACTGGCCATGG + Intronic
1061949319 9:133927408-133927430 TCTGCTGTGTTCTCTGACCGTGG - Intronic
1062051163 9:134447811-134447833 CCTGGCGTGTTCACTGGCACTGG - Intergenic
1062060514 9:134493003-134493025 CCTGGGGTCTGCACAGACCAGGG + Intergenic
1062195702 9:135272730-135272752 CCTTGTGTGTTTTCTCACCAAGG - Intergenic
1062736732 9:138141529-138141551 CCAGGTGTGTGCAGAGACCACGG + Intergenic
1185484305 X:470742-470764 CCTGGTGTGATCACAGCTCACGG + Intergenic
1187481297 X:19658282-19658304 CCTGCTGTGTTCATTCACCTCGG + Intronic
1189561311 X:42194098-42194120 CCTGGTGACTTCCCTGAACATGG - Intergenic
1195736660 X:108019065-108019087 CCTGCTATGCTCACTGCCCAGGG - Intergenic
1196619653 X:117807357-117807379 CTTGCTGTGGTCACTGACCCTGG - Intergenic
1201768573 Y:17595846-17595868 CTTGTTGTGTTCTCTGACCCTGG + Intergenic
1201832981 Y:18310139-18310161 CTTGTTGTGTTCTCTGACCCTGG - Intergenic