ID: 1126163503

View in Genome Browser
Species Human (GRCh38)
Location 15:45634898-45634920
Sequence TGTTCACTGACCATGGTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163495_1126163503 15 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163503 15:45634898-45634920 TGTTCACTGACCATGGTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 148
1126163497_1126163503 2 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163503 15:45634898-45634920 TGTTCACTGACCATGGTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 148
1126163499_1126163503 1 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163503 15:45634898-45634920 TGTTCACTGACCATGGTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 148
1126163496_1126163503 3 Left 1126163496 15:45634872-45634894 CCCCGTGAGCGCTCAACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1126163503 15:45634898-45634920 TGTTCACTGACCATGGTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163503 Original CRISPR TGTTCACTGACCATGGTGCC TGG Exonic
902871468 1:19316088-19316110 TACTCACTGTCCAGGGTGCCCGG + Intronic
906286710 1:44592463-44592485 TGGCCACTGACCACTGTGCCTGG + Intronic
906515361 1:46435905-46435927 TGTGCAGTGACCACGGTGGCTGG + Intergenic
909583544 1:77264139-77264161 TTATCACTTAACATGGTGCCTGG + Intergenic
915300146 1:154947103-154947125 TGTTAACTGATCATGGCACCTGG + Intronic
915300636 1:154949620-154949642 TGTTAACTGATCATGGCACCTGG + Intronic
915486065 1:156221564-156221586 TCTTCACTCATCACGGTGCCTGG + Intronic
918213377 1:182371400-182371422 TGTTTACTGAGAATGGTTCCAGG - Intergenic
921337729 1:214105167-214105189 TGTTGAATGACCATGATGCAAGG - Intergenic
921597598 1:217071521-217071543 TGTTCACTTACCATGTAACCAGG - Intronic
921609418 1:217193731-217193753 TGGTCACTGTCCTTGGTGCTGGG - Intergenic
922431769 1:225561692-225561714 TGTCCACTGAGCATGCTGTCAGG + Intronic
922678242 1:227566503-227566525 TGCTCACTGACCATTCTGTCTGG - Intronic
922928200 1:229368209-229368231 TGTACAATAAGCATGGTGCCAGG + Intergenic
1064343327 10:14506916-14506938 TAAGCACTGAGCATGGTGCCTGG + Intergenic
1065360132 10:24881756-24881778 TGTTCATTGGCCATGGTGAGAGG - Intronic
1067044604 10:42977308-42977330 TGGTCTCTGACCATGAGGCCAGG - Intergenic
1069257393 10:66350492-66350514 TGTTCATTGACTATGGAGTCAGG - Intronic
1069570209 10:69490110-69490132 TGTTCCCTGACCACAGTGTCAGG - Intronic
1070392000 10:75979434-75979456 AGTTTATTGAACATGGTGCCAGG + Intronic
1071079516 10:81794229-81794251 TGTTCACTCTCCATGGAACCAGG + Intergenic
1072719648 10:97772459-97772481 TCTTCATTGAGCTTGGTGCCAGG + Intergenic
1073917981 10:108428212-108428234 TGTTGACTGACCATAGTCCTTGG - Intergenic
1076490701 10:130859403-130859425 TGTGCACTCTCCCTGGTGCCTGG + Intergenic
1077978248 11:7272570-7272592 TGGTCACTGTCCTTGGTGCTGGG + Intronic
1078867397 11:15310750-15310772 TGGTGACTGACCATCGTGGCAGG - Intergenic
1081051595 11:38349041-38349063 TGTACAGGGAGCATGGTGCCAGG + Intergenic
1081630582 11:44686884-44686906 TGCTCCCTGCCCATGCTGCCTGG + Intergenic
1081880458 11:46446130-46446152 TGCTCTCTGCCAATGGTGCCAGG + Intronic
1081994208 11:47353048-47353070 TGTCCACAGACCCTGGGGCCAGG + Intergenic
1090054567 11:123411357-123411379 TTATCACCTACCATGGTGCCTGG + Intergenic
1090186584 11:124743044-124743066 GGTTCATTGGTCATGGTGCCTGG - Intronic
1091679760 12:2518787-2518809 TGTTGAGTGATCATGCTGCCAGG + Intronic
1097497899 12:60365266-60365288 TGTTAATTCACCAGGGTGCCTGG + Intergenic
1097563218 12:61234682-61234704 TGTTCAATAACAATGGTGACAGG + Intergenic
1102001143 12:109558736-109558758 TGGTGACTGACCAGGGAGCCAGG - Intronic
1102329465 12:112016429-112016451 TGTTCACTTAGTATGGTGCCTGG + Intronic
1103887238 12:124211764-124211786 GGATCACTGAGGATGGTGCCTGG + Intronic
1104862622 12:131931991-131932013 TGCTCACTCACCCTGGGGCCGGG - Intronic
1105952791 13:25245943-25245965 TGTTTACTGACCATGATGGGTGG + Intergenic
1105981119 13:25517369-25517391 TGACCACTGAGCATGCTGCCAGG - Intronic
1106795759 13:33203199-33203221 TGTTCACAGAACAGGGTGCGTGG + Intronic
1108072184 13:46639705-46639727 TGTTCACTGCCCAGGGTCTCAGG + Intronic
1110544343 13:76739343-76739365 TGTCCACTGGCCAAGCTGCCAGG + Intergenic
1115225692 14:31099307-31099329 AGTTCGCTAACCCTGGTGCCAGG + Intergenic
1119445610 14:74661056-74661078 TGATTGCTGTCCATGGTGCCAGG - Intronic
1119711630 14:76826689-76826711 TTGTCATTGTCCATGGTGCCAGG - Intronic
1121325723 14:93018584-93018606 TGTTCCCTCCCCATGGTGACAGG + Intronic
1124014126 15:25862239-25862261 TGTTCAGAGACCACTGTGCCTGG + Intronic
1124499782 15:30217403-30217425 CAATCATTGACCATGGTGCCTGG + Intergenic
1124743797 15:32321261-32321283 CAATCATTGACCATGGTGCCTGG - Intergenic
1125735903 15:41925767-41925789 TGTTCCCAGAACATGGAGCCAGG - Intronic
1126163503 15:45634898-45634920 TGTTCACTGACCATGGTGCCTGG + Exonic
1127723642 15:61726493-61726515 TGTTTACTGACCCTTGTTCCGGG - Intergenic
1128715342 15:69903716-69903738 TGTGCACTCACCATGTGGCCAGG - Intergenic
1131294301 15:91133700-91133722 TGTCCAGTGACCCTGCTGCCTGG - Intronic
1133903741 16:10001679-10001701 GATTCACTGGCCATGGTGACTGG - Intronic
1140312082 16:73859245-73859267 TGTTCTTTTACCATTGTGCCTGG - Intergenic
1141392992 16:83680302-83680324 TGATCACTAGCCAAGGTGCCTGG - Intronic
1141441208 16:84030810-84030832 GGTACACTGAGCATGGGGCCTGG + Intronic
1141684014 16:85559982-85560004 GGTCCACTGAAGATGGTGCCTGG + Intergenic
1141803697 16:86328267-86328289 TGTTTACTGCCCAAGGTGCCTGG + Intergenic
1142483110 17:230508-230530 TGTTCTCTGTCCAGGATGCCTGG - Intronic
1149406334 17:56355517-56355539 TGAACACTGACCATGGTCTCAGG - Intronic
1151329785 17:73399993-73400015 TGTTCACGGGGCATGGTGCTGGG - Intronic
1152630984 17:81410619-81410641 TCTGCACTGCCCGTGGTGCCAGG - Intronic
1155072127 18:22325642-22325664 TGTTCCATGACCCTGGTGGCTGG - Intergenic
1155528513 18:26742251-26742273 TGTGCAATGAACATTGTGCCAGG - Intergenic
1157602173 18:48901006-48901028 AGTTCACTGACGATAGTGACAGG + Intergenic
1160459069 18:79023952-79023974 CGAGCACTGACCATGCTGCCAGG - Intergenic
1162791356 19:13064640-13064662 TGTTCACTGGCAGTGGTCCCTGG + Intronic
1163457224 19:17414495-17414517 TGTTGATTGACCATGGACCCAGG - Intronic
1163694838 19:18758873-18758895 TGTTCCCAGATCATGGTGGCAGG - Intronic
1165156674 19:33792996-33793018 TGCCCACTGAGCGTGGTGCCAGG + Intergenic
1165219700 19:34305317-34305339 TGTTCATCCACCATTGTGCCTGG + Intronic
1168054267 19:53852992-53853014 TGTTCACTGGCCATGTCCCCTGG + Intergenic
926292681 2:11543083-11543105 TCTTTACTTCCCATGGTGCCCGG - Intronic
928097105 2:28411457-28411479 TGTTCTATGGCCTTGGTGCCAGG - Intronic
936094054 2:109518299-109518321 TGTTAACTGAGCACGGTGCTGGG + Intergenic
936246627 2:110834067-110834089 TGTTAACTGACCATGTTTGCGGG + Intronic
936287814 2:111194601-111194623 TGGGCACTGACCGAGGTGCCAGG + Intergenic
939607812 2:144274155-144274177 TGTTCTCTAACCATGGTTCCTGG + Intronic
940154161 2:150636387-150636409 TCTTGACTGAACATCGTGCCTGG + Intergenic
940767859 2:157809454-157809476 TGTGCACTGACCCTGGTACATGG - Intronic
946757829 2:222964769-222964791 TCCTTACTGACCATGGTGCTCGG - Intergenic
947602244 2:231460949-231460971 TGTTAACTAAACATGGTGACAGG - Intronic
948059699 2:235033727-235033749 TGCTCACTGCACATGGAGCCTGG + Intronic
948067495 2:235092130-235092152 AGTTCAGTGACCAGGCTGCCAGG + Intergenic
948177855 2:235958288-235958310 TCTTCCCTGACCCTGGAGCCTGG - Intronic
948242112 2:236446625-236446647 TGTTCACCAACCGTGGTGCCTGG + Intronic
1171024411 20:21615756-21615778 TGGTCCCTCACCAAGGTGCCAGG - Intergenic
1171044702 20:21798851-21798873 TGTGCAGTGACCTTGGTGACAGG + Intergenic
1175852387 20:62100480-62100502 AGTTCACTGAGAAAGGTGCCTGG + Intergenic
1181976643 22:26735619-26735641 TGGACACTGAGCATGGTGCCTGG + Intergenic
1182520547 22:30882229-30882251 TATTCACTAACCAGGCTGCCTGG - Intronic
1183303160 22:37068478-37068500 CGTTCACTGACCAGAGTCCCTGG - Intronic
1183616404 22:38948468-38948490 TCTTCCCTGACTATGTTGCCAGG - Intergenic
1184425272 22:44405664-44405686 TGTTAAATGACCATGGGGACAGG + Intergenic
949133848 3:538079-538101 TGTTCACTCATTATGGTTCCTGG - Intergenic
951272867 3:20648962-20648984 TGTTCACTAGGCATTGTGCCAGG + Intergenic
955055250 3:55448795-55448817 TGTTCAGTGTCCAGGGTGCTGGG - Intergenic
958884875 3:99714588-99714610 TGTTCATTGACAATAGTCCCAGG + Intronic
960198414 3:114799739-114799761 TGCCCACTGAGCATGGTGCCTGG - Intronic
961308470 3:125976418-125976440 TGTTCACTGCACAAGGTGCTTGG - Intronic
961413866 3:126743375-126743397 TTTTCTCTGGCTATGGTGCCTGG + Intronic
961540661 3:127597210-127597232 TGTTCACTGCACAAAGTGCCTGG + Intronic
963264677 3:143228574-143228596 TGTTCACTGCCCCTAGGGCCTGG + Intergenic
963708009 3:148712610-148712632 TGTTCACTGACCAGGCTGGAGGG - Intronic
967020025 3:185514734-185514756 TGATGCCTGACCATGGTGACTGG - Intronic
968543107 4:1178250-1178272 TGTGCAGAGCCCATGGTGCCTGG - Intronic
968543117 4:1178293-1178315 TGTGCAGAGCCCATGGTGCCTGG - Intronic
970229173 4:13891306-13891328 TGTGCTCTGAGCATGGTGCTGGG - Intergenic
970998671 4:22297234-22297256 TATTCACTGACATTAGTGCCAGG + Intergenic
978408797 4:108407073-108407095 TATTCAATTACCATGGTGGCAGG - Intergenic
979542426 4:121900511-121900533 TGTTCTCTTACAATTGTGCCTGG + Intronic
980787599 4:137574791-137574813 TGTGCAGTGACCATGATTCCTGG + Intergenic
982158992 4:152548499-152548521 TGTGCCCTGACCCTTGTGCCAGG + Intergenic
991544463 5:67766038-67766060 TGTTCTAGGACCATGGTGCCTGG - Intergenic
996709614 5:126531262-126531284 TGTTCATTGAGCAAGATGCCTGG - Intergenic
997386193 5:133474709-133474731 TTTCCACTGACCCTGGTGCTCGG - Intronic
998113008 5:139516556-139516578 TGTTCACAGAGCAATGTGCCTGG - Intergenic
998766405 5:145492854-145492876 TCTAGACTGACCCTGGTGCCAGG - Intronic
999146884 5:149402165-149402187 AGTGCACTGACCATGGTGGAAGG + Intronic
1003734338 6:8861002-8861024 TGTTCACTGATCATGGTCCAAGG - Intergenic
1006719018 6:36138262-36138284 TGATCAGTTGCCATGGTGCCCGG + Intronic
1011070055 6:83371501-83371523 TGTTCACAGGCCTTGTTGCCGGG + Intronic
1011463686 6:87632713-87632735 TGTTAACTGGGCATGGTGGCAGG + Intronic
1017658944 6:156655470-156655492 TGTAAACTAACTATGGTGCCTGG + Intergenic
1017978197 6:159376025-159376047 TGTTGACTGAGCTTGGAGCCAGG - Intergenic
1019382321 7:730488-730510 TCTTCACTGTGCATGGTTCCAGG + Intronic
1022970734 7:35514354-35514376 CATTAACTGAACATGGTGCCAGG + Intergenic
1023089430 7:36603979-36604001 TGTTCACTGTTCATGGAGACTGG + Intronic
1023092189 7:36627738-36627760 TATTCAATGACCATGCAGCCTGG + Intronic
1024603257 7:51005351-51005373 TGTACCTTGCCCATGGTGCCTGG + Intergenic
1024675833 7:51637261-51637283 AGATGACTGACCATGCTGCCAGG - Intergenic
1026411362 7:70126456-70126478 TATTCCCAGACCATGTTGCCTGG + Intronic
1026814264 7:73497425-73497447 TCTTGACTGAGAATGGTGCCAGG + Intronic
1027974755 7:85137795-85137817 TGTTCATTGACTATTTTGCCTGG - Intronic
1031475979 7:122222338-122222360 TGGCCATAGACCATGGTGCCTGG - Intergenic
1032349343 7:131145848-131145870 AATTCCCTGACCCTGGTGCCCGG + Intronic
1034278032 7:149832638-149832660 TCTTCACTGAGCAGGGTGGCTGG - Intergenic
1034681867 7:152934942-152934964 TCTCCACTTACCATGGTCCCGGG - Intergenic
1037984990 8:23284916-23284938 TAATCCCTGACCTTGGTGCCTGG + Intronic
1039476422 8:37841532-37841554 TCTTCACTCACCACTGTGCCAGG + Exonic
1041493431 8:58460459-58460481 TGCTCACTGACCATGCTCCCTGG + Intergenic
1042548092 8:69969032-69969054 TGTTCATTGACAATGGGACCTGG + Intergenic
1043491784 8:80756258-80756280 TGTTCACAGATCTGGGTGCCAGG - Intronic
1044045857 8:87431025-87431047 TGTTCAATTACCATGGAGGCAGG + Intronic
1047717076 8:127605396-127605418 TTTTCCCTGACCATGGAGCCAGG + Intergenic
1048204618 8:132405390-132405412 TGTTCACTGCCACTGGTGGCTGG - Intronic
1048988073 8:139746023-139746045 TGCACACTGGCCTTGGTGCCAGG - Intronic
1049505422 8:142993991-142994013 TGTTCAAGCACCATGGGGCCAGG + Intergenic
1054391209 9:64620669-64620691 GGTCCACTGACCCTGGGGCCAGG - Intergenic
1057279632 9:93700453-93700475 TGTTCACTGAGCTGGGTGCTGGG + Intergenic
1057974272 9:99587695-99587717 TCTTGACTGACCATGGTCCCAGG + Intergenic
1061110837 9:128569385-128569407 TGGTCAATGACCATGGTGATGGG + Intronic
1203790812 EBV:150736-150758 TGTTCTCTGAGCATGGACCCCGG - Intergenic
1187190745 X:17032575-17032597 TGTTTACTGGGCATGGTGCTAGG + Intronic
1188516718 X:30995295-30995317 TGGACACTGACTTTGGTGCCAGG - Intergenic
1199233752 X:145468049-145468071 TGGTTACTGGCCATGGCGCCCGG - Intergenic