ID: 1126163504

View in Genome Browser
Species Human (GRCh38)
Location 15:45634899-45634921
Sequence GTTCACTGACCATGGTGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163499_1126163504 2 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163504 15:45634899-45634921 GTTCACTGACCATGGTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
1126163496_1126163504 4 Left 1126163496 15:45634872-45634894 CCCCGTGAGCGCTCAACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1126163504 15:45634899-45634921 GTTCACTGACCATGGTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
1126163495_1126163504 16 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163504 15:45634899-45634921 GTTCACTGACCATGGTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
1126163497_1126163504 3 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163504 15:45634899-45634921 GTTCACTGACCATGGTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163504 Original CRISPR GTTCACTGACCATGGTGCCT GGG Exonic
900765839 1:4504923-4504945 GTTTACTGACCATGGTCTCCTGG + Intergenic
901905792 1:12408733-12408755 GGTCACTGGACTTGGTGCCTTGG - Intronic
902930647 1:19728878-19728900 GGTCAGTGAGAATGGTGCCTTGG + Intronic
903051989 1:20608204-20608226 TTTCACTGACCCTGAAGCCTGGG - Intronic
903662258 1:24985340-24985362 GACCACTCACCATGGAGCCTGGG + Intergenic
903667401 1:25016503-25016525 GTTATCTGACCCTGGTGCTTAGG + Intergenic
906286711 1:44592464-44592486 GGCCACTGACCACTGTGCCTGGG + Intronic
911300552 1:96167639-96167661 GTTCACTGACTGTGTTTCCTTGG + Intergenic
916744787 1:167676762-167676784 GTTCACAGCCTCTGGTGCCTGGG - Intronic
918801100 1:188972924-188972946 GTTAACTGATCATTGTGTCTAGG + Intergenic
922751540 1:228072422-228072444 GGACACTGAGCACGGTGCCTTGG - Intergenic
1070112554 10:73499040-73499062 GGTCTCTGACCAGGGTGCCCAGG + Exonic
1071482265 10:86073710-86073732 CATCACTGATCGTGGTGCCTTGG - Intronic
1073667236 10:105547199-105547221 GTGTACTGACCATGCTGGCTAGG - Intergenic
1078595625 11:12684052-12684074 GGTCACTGTCCAGGGTGACTTGG - Intronic
1080542408 11:33280594-33280616 GTTCACAGAGCATAGTGGCTGGG + Intronic
1082185910 11:49181301-49181323 TTTCACTGACCATGTTGGCGAGG + Intronic
1085272957 11:75281155-75281177 GGTCACTGACCACAGGGCCTTGG + Intronic
1102416770 12:112769723-112769745 GTTCACTGACCATATGGACTGGG + Intronic
1106636530 13:31534502-31534524 ATTCACTCACTATGGTGACTTGG + Intergenic
1108125430 13:47237741-47237763 AGTCACTGACGATGGTTCCTAGG + Intergenic
1112016288 13:95334165-95334187 GTGCAGTGACCATGGTACCAAGG + Intergenic
1119229315 14:72968062-72968084 GTTCACTCACCACGTTGCCCAGG + Intergenic
1121456999 14:94044645-94044667 GTTCAACGACCAGAGTGCCTCGG + Exonic
1124499783 15:30217404-30217426 AATCATTGACCATGGTGCCTGGG + Intergenic
1124743796 15:32321260-32321282 AATCATTGACCATGGTGCCTGGG - Intergenic
1126163504 15:45634899-45634921 GTTCACTGACCATGGTGCCTGGG + Exonic
1126691585 15:51292955-51292977 CTCCACTGCCCATGGTGTCTTGG + Intronic
1128533229 15:68469378-68469400 GTCTACTGAACATGGTGCGTGGG + Intergenic
1130368346 15:83261218-83261240 GTTCACTAATTAGGGTGCCTTGG + Intronic
1131294300 15:91133699-91133721 GTCCAGTGACCCTGCTGCCTGGG - Intronic
1132891293 16:2206097-2206119 GGTCACTGCCCACCGTGCCTGGG - Exonic
1140535936 16:75709804-75709826 CTTCACTGACCATGCTGTCCTGG - Intronic
1141441209 16:84030811-84030833 GTACACTGAGCATGGGGCCTGGG + Intronic
1141592088 16:85076140-85076162 GTTGACTGACCAGGGTGCAAAGG + Intronic
1141684015 16:85559983-85560005 GTCCACTGAAGATGGTGCCTGGG + Intergenic
1143370663 17:6437001-6437023 ATTTACTGACCTTGTTGCCTTGG + Intergenic
1152167729 17:78721619-78721641 GTTCACAGGCGATGCTGCCTGGG + Intronic
1153672823 18:7428759-7428781 GTCCTCTGACCCTGCTGCCTGGG + Intergenic
1158657302 18:59350004-59350026 GTTCCCTTACTCTGGTGCCTTGG - Intronic
1158856822 18:61550960-61550982 GTTAGATGGCCATGGTGCCTAGG - Intronic
1160163595 18:76492666-76492688 TTTCTCTGGCCTTGGTGCCTGGG - Intronic
1161598670 19:5166540-5166562 TTTCACTGAGCATGATGCCAAGG - Intronic
1162124690 19:8493184-8493206 TTTCACTCACCAGGGTTCCTGGG - Intronic
1162791357 19:13064641-13064663 GTTCACTGGCAGTGGTCCCTGGG + Intronic
1165037833 19:33047352-33047374 GTTCTCTGACCATTGTGCCCTGG + Intronic
1165838879 19:38774947-38774969 GGTCCCTGAGCTTGGTGCCTTGG - Intergenic
1166737898 19:45097041-45097063 GTTCACTGGCCATGGGGCTGTGG + Intronic
1168054268 19:53852993-53853015 GTTCACTGGCCATGTCCCCTGGG + Intergenic
943261675 2:185672538-185672560 GTTCACTGACCCCAGTTCCTAGG - Intergenic
943960188 2:194254331-194254353 CTACAGTGACCATGGTGCCAAGG - Intergenic
946767481 2:223053585-223053607 GTACACTGACTTTGGGGCCTGGG + Exonic
948059700 2:235033728-235033750 GCTCACTGCACATGGAGCCTGGG + Intronic
948242113 2:236446626-236446648 GTTCACCAACCGTGGTGCCTGGG + Intronic
948864711 2:240769377-240769399 GATCCCTGACCATGGTGCAGAGG - Intronic
1176157102 20:63627313-63627335 GTCCACTGACCATCGTCCCTCGG - Intergenic
1178709680 21:34905104-34905126 GTTCACTGTGCACGGTGTCTGGG - Intronic
1181573941 22:23782302-23782324 GTTCCCGGTCCATGCTGCCTTGG + Exonic
1181644586 22:24224316-24224338 GGTCTCTCACCATGTTGCCTAGG - Intronic
1182433001 22:30311594-30311616 CTTCACTGGCCTTGGTGCCCTGG + Intronic
1182520546 22:30882228-30882250 ATTCACTAACCAGGCTGCCTGGG - Intronic
1182595862 22:31419850-31419872 GTTTCCTCACCATGTTGCCTGGG - Intronic
1184003756 22:41694092-41694114 GTTCACCCACCTTGGAGCCTGGG - Exonic
950330496 3:12152433-12152455 GTACTCTCACCATTGTGCCTTGG - Intronic
956342490 3:68241582-68241604 AGTCACTTCCCATGGTGCCTTGG + Intronic
956899941 3:73704794-73704816 GTTCACAGACCAGGGTACATTGG + Intergenic
960967669 3:123116398-123116420 GATGACTGACCCTGCTGCCTGGG + Intronic
962059335 3:131908808-131908830 ATTCACTGACCATGTATCCTTGG + Intronic
962364998 3:134772951-134772973 GTTAACTGACCACAGTGCCTTGG - Intronic
966928224 3:184659298-184659320 GCTCAATGGCCATCGTGCCTGGG - Intronic
968936147 4:3611551-3611573 GTTTCCTGACCCTGCTGCCTGGG + Intergenic
976501762 4:85798250-85798272 TTTCACTGAGCATAATGCCTTGG - Intronic
982400843 4:154966220-154966242 GTCCAAAGACCTTGGTGCCTAGG - Intergenic
990158954 5:52915021-52915043 GTTCACTGAACTTTGTGGCTGGG - Intronic
994498371 5:100542140-100542162 TTTCACTGTCCATGTTCCCTGGG + Intronic
1001227845 5:169960979-169961001 GTTCACTATCCATGGAGTCTTGG + Intronic
1008526208 6:52409718-52409740 GTTCATTGTCCATGGGCCCTTGG + Intergenic
1010799521 6:80158825-80158847 GATCACCCACCATGTTGCCTTGG - Intronic
1014375748 6:120670998-120671020 GTAAACTGACCATGGTTCCTTGG + Intergenic
1016293985 6:142554165-142554187 GTTCACTGGACATGGTGGCATGG - Intergenic
1017658945 6:156655471-156655493 GTAAACTAACTATGGTGCCTGGG + Intergenic
1023089431 7:36603980-36604002 GTTCACTGTTCATGGAGACTGGG + Intronic
1024675832 7:51637260-51637282 GATGACTGACCATGCTGCCAGGG - Intergenic
1026411363 7:70126457-70126479 ATTCCCAGACCATGTTGCCTGGG + Intronic
1031475978 7:122222337-122222359 GGCCATAGACCATGGTGCCTGGG - Intergenic
1032080783 7:128857430-128857452 GTAAACTGACCATGATGTCTGGG - Intronic
1032091470 7:128913730-128913752 GTAAACTGACCATGATGTCTGGG + Intergenic
1034189262 7:149201304-149201326 GATGAAAGACCATGGTGCCTGGG - Intronic
1034278031 7:149832637-149832659 CTTCACTGAGCAGGGTGGCTGGG - Intergenic
1036738718 8:11342264-11342286 GTCCACAGAGCATGGTCCCTGGG + Intergenic
1048204617 8:132405389-132405411 GTTCACTGCCACTGGTGGCTGGG - Intronic
1051274263 9:15383991-15384013 GTTCAAGGACCATGTTGTCTAGG + Intergenic
1053055793 9:34992413-34992435 GTTCACTCACACTGGTGCTTAGG + Intronic
1054730275 9:68695015-68695037 GAGTACTGACCATGTTGCCTAGG - Intergenic
1054739373 9:68789161-68789183 GATAACTGTCAATGGTGCCTTGG - Intronic
1057342012 9:94211369-94211391 GTATACTGACCATGTGGCCTTGG - Intergenic
1061955930 9:133961336-133961358 TTCCACTGCCCATGGTGTCTTGG - Intronic
1188523490 X:31063618-31063640 CTTCACTCACCATGGCACCTGGG + Intergenic
1195236270 X:102901749-102901771 GTAAACTGACCATGGGACCTGGG + Intergenic