ID: 1126163505

View in Genome Browser
Species Human (GRCh38)
Location 15:45634905-45634927
Sequence TGACCATGGTGCCTGGGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 382}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163499_1126163505 8 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG 0: 1
1: 0
2: 6
3: 40
4: 382
1126163497_1126163505 9 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG 0: 1
1: 0
2: 6
3: 40
4: 382
1126163496_1126163505 10 Left 1126163496 15:45634872-45634894 CCCCGTGAGCGCTCAACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG 0: 1
1: 0
2: 6
3: 40
4: 382
1126163495_1126163505 22 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG 0: 1
1: 0
2: 6
3: 40
4: 382
1126163500_1126163505 -8 Left 1126163500 15:45634890-45634912 CCCTGGTGTGTTCACTGACCATG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG 0: 1
1: 0
2: 6
3: 40
4: 382
1126163501_1126163505 -9 Left 1126163501 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG 0: 1
1: 0
2: 6
3: 40
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163505 Original CRISPR TGACCATGGTGCCTGGGCTG CGG Exonic
900149499 1:1171903-1171925 TGTCCCTGGGGCCTGAGCTGTGG - Intergenic
900314006 1:2048174-2048196 TGGCCATGGGGCCTGGAGTGGGG + Intergenic
900628112 1:3618761-3618783 TCTCCATGGAGCCAGGGCTGGGG - Intergenic
900645850 1:3708423-3708445 TGAGCATGGTGCCTGGCTCGAGG - Intronic
900983822 1:6061501-6061523 TGTCAATGGTGCCAGGGTTGAGG - Intronic
901843402 1:11967095-11967117 GGACCCTGATGCCTGGGCTGGGG + Intronic
902548680 1:17206377-17206399 TGACCCCGGTGGCAGGGCTGGGG + Intronic
903662262 1:24985346-24985368 TCACCATGGAGCCTGGGCTGGGG + Intergenic
904264185 1:29308606-29308628 TCACTATGTTGCCTAGGCTGGGG + Intronic
904638755 1:31905376-31905398 TGGCCATGTTGCCCAGGCTGTGG + Intergenic
904997579 1:34642925-34642947 TGTCCATGGCTCCTGGCCTGAGG + Intergenic
905136842 1:35807139-35807161 TGACCATGCTGCCTTGGAGGTGG + Intergenic
906269480 1:44463857-44463879 TGTCCCTGGAGCCTGGGCTCAGG - Intronic
906446558 1:45904497-45904519 TGGCTATGTTGCCTAGGCTGGGG + Intronic
907150324 1:52280090-52280112 GCACCATGGTGCCTGGTCTTAGG - Intronic
908525074 1:64980211-64980233 TCAACACGGTGCCTGGACTGTGG + Intergenic
909115910 1:71536286-71536308 TGCCCATGGTGTTTGGGCTACGG + Intronic
910969083 1:92836409-92836431 AGACCTTGGTGCCTGGACCGTGG + Intronic
911063087 1:93764461-93764483 AGGGCTTGGTGCCTGGGCTGGGG - Intronic
915310766 1:155004855-155004877 TGACCCCTGTGCCAGGGCTGGGG - Intronic
915339256 1:155167353-155167375 TGCCCATGGTGCCTACGCAGTGG + Intergenic
915940001 1:160113109-160113131 AGGCCAAGATGCCTGGGCTGGGG - Intergenic
916017248 1:160761142-160761164 TGGCCATGGTGGCGGGGATGGGG - Intergenic
918229187 1:182512960-182512982 TGTCCATGGAGCCTGGGGTTTGG + Intronic
918295048 1:183148656-183148678 TGACCATGGTCTCTGTGTTGGGG + Intergenic
919656294 1:200200526-200200548 TGCCCATGGAGCCTGGGGTTTGG - Intergenic
919944658 1:202310363-202310385 TGACCAGGGGCCCTGGGTTGGGG + Intronic
920197554 1:204239216-204239238 TGGCCATGGTGGCAGGGATGGGG + Intronic
920915416 1:210254354-210254376 TGGGCATGTAGCCTGGGCTGAGG - Intergenic
921259135 1:213370016-213370038 TCACTATGGTGCCTGTGTTGAGG + Intergenic
921746539 1:218746840-218746862 TGAAAATGGTCCATGGGCTGAGG - Intergenic
922970862 1:229736737-229736759 TGAGCATGGTGCCTTAGCTTAGG + Intergenic
923166219 1:231365438-231365460 TTGCCATGTTGCCTAGGCTGGGG - Exonic
923426579 1:233876101-233876123 TAACCATGGTGGCAGGGGTGGGG + Intergenic
923538525 1:234871436-234871458 TGAGCATGGGGCCCCGGCTGAGG - Intergenic
924492683 1:244554490-244554512 TCACCATGTTGCCCTGGCTGGGG - Intronic
924580321 1:245317735-245317757 GGACCAAGGGGCCTGGGCAGAGG + Intronic
924763299 1:247008458-247008480 TGACCAGGCAGCCTGAGCTGTGG + Intergenic
1063179367 10:3584010-3584032 TGCCCATGATCCCTGGCCTGGGG - Intergenic
1066447687 10:35498598-35498620 TGACCATCCTGCCTGGATTGGGG - Intronic
1067026139 10:42845795-42845817 TGGCCATGGTGGCAGGGATGAGG - Intergenic
1067243613 10:44517510-44517532 GAACCATGTTGCCTGGGCTGTGG - Intergenic
1067267129 10:44756056-44756078 TGGCAATGGTGCGTGGGCTGTGG + Intergenic
1067569067 10:47358627-47358649 TGGCCAGGGAGCCTGGGCAGCGG + Intergenic
1069896798 10:71685080-71685102 TGACCAAGGTTCCAGGCCTGTGG - Intronic
1070599631 10:77856689-77856711 CAACCATGGGGCCTGGGCAGGGG + Intronic
1072986055 10:100141671-100141693 TGAGGATGGGGCCAGGGCTGAGG + Intergenic
1073214844 10:101830495-101830517 TGACCATTGTGACCAGGCTGAGG - Intronic
1073461517 10:103668310-103668332 TGGCCATGCTGCCTTGGGTGGGG - Intronic
1074736960 10:116445601-116445623 TGACCTTAGGGCCTGAGCTGTGG + Intronic
1075084515 10:119405564-119405586 TGACGCTGGTGCCTGGGTGGGGG - Intronic
1075279081 10:121123315-121123337 GGGCCGTGGTGCCAGGGCTGTGG + Intergenic
1076318716 10:129563243-129563265 TGGCCATGGTCCCAGGCCTGCGG + Intronic
1076538700 10:131199722-131199744 TGATGATGGTGCCTGGTATGTGG - Intronic
1076875714 10:133214603-133214625 TGAGCCTGGCCCCTGGGCTGGGG + Intronic
1077129562 11:964021-964043 TGTCAGTGGTGCCAGGGCTGAGG + Intronic
1077144236 11:1037566-1037588 TGACCAGGGGGCCTTGCCTGTGG + Intergenic
1077183036 11:1224844-1224866 TGACCATGCTGTGGGGGCTGGGG + Intronic
1077530031 11:3090739-3090761 TGTCCCTGGGGCCTGGGCAGGGG - Intronic
1080052879 11:27874626-27874648 TGAACCTGCTGCCTGGTCTGAGG + Intergenic
1080851653 11:36075456-36075478 TGACCATGGTCCCTTGGCTGAGG + Intronic
1081127658 11:39340952-39340974 TCACCCTGGTGCCTTGGCTGGGG + Intergenic
1081366928 11:42246921-42246943 TCAGCATGGTGCTTGGGTTGGGG + Intergenic
1081420734 11:42873188-42873210 TGCTCATGGTGCCTGGGGTTTGG - Intergenic
1081746884 11:45479649-45479671 TGCCCTTGGTGCCTAGGATGGGG - Intergenic
1082862174 11:57867201-57867223 TGAACTTGGTGACTGGGGTGTGG + Intergenic
1082881294 11:58040917-58040939 TGGCCATGGTGTCTTTGCTGTGG + Intronic
1083618284 11:64036779-64036801 AGACCATGGTGCCTGGGCGGGGG + Intronic
1083962129 11:66020474-66020496 TGACCAGGGTGAGAGGGCTGGGG + Intronic
1084268663 11:68017681-68017703 TGGCCCTGGCCCCTGGGCTGTGG + Intronic
1084437339 11:69151594-69151616 TGCCCATTGTCCTTGGGCTGGGG + Intergenic
1084441429 11:69176278-69176300 TCACCCTGTTACCTGGGCTGGGG + Intergenic
1084488030 11:69462468-69462490 TGGCCAGGGTTGCTGGGCTGAGG + Intergenic
1084603681 11:70160799-70160821 TGGGGATGGTGCCTGGGCTCCGG + Intronic
1085040509 11:73323829-73323851 TGGACGTGGTGCCTGGGCAGTGG + Intronic
1085519373 11:77129203-77129225 TGAAGATGGTGCCCAGGCTGTGG - Intronic
1085603073 11:77872748-77872770 TCACCATGTTGGCTAGGCTGGGG - Intronic
1085641560 11:78196230-78196252 TGTCCATGGCGCCCGCGCTGCGG - Exonic
1085947589 11:81290612-81290634 TGGGCGTGGTGTCTGGGCTGAGG - Intergenic
1086935068 11:92736381-92736403 TGAACATGGTTCGTGGTCTGAGG - Intronic
1088038405 11:105347027-105347049 TGGCCATGGTGGCAGGGATGGGG + Intergenic
1088742491 11:112778447-112778469 TCAGCATGGGGCCTGGGCAGAGG - Intergenic
1089574052 11:119429017-119429039 TGCCCATGTTGCCCAGGCTGGGG - Intergenic
1090199913 11:124846490-124846512 TGACCCAGCTGCCAGGGCTGTGG + Intergenic
1090203229 11:124870521-124870543 TGACCCTGGTGTCTGTCCTGGGG + Intronic
1090379795 11:126318441-126318463 TTACCATGCAGCCAGGGCTGAGG + Intronic
1091461132 12:643973-643995 AGACCATGGTTCCTGCGCTCAGG - Intronic
1091738681 12:2944246-2944268 TCTCCATGGTGCCTTCGCTGAGG - Intergenic
1092246210 12:6865842-6865864 GGCACATGGTGGCTGGGCTGTGG + Intronic
1092526966 12:9315322-9315344 TGAGCCTGGTGCCAGGGCAGTGG + Intergenic
1096578083 12:52567094-52567116 TGACCTTGGGGCCAGCGCTGTGG - Exonic
1096873452 12:54609298-54609320 TGTTCATGGTTTCTGGGCTGTGG + Intergenic
1096877987 12:54645331-54645353 TGCCCATGGTGCCTAGGAAGCGG - Intronic
1099566873 12:84262080-84262102 TGACCATAGTGCCTGGTCACAGG + Intergenic
1101727535 12:107400639-107400661 AGAGCATGGTGTCTGGGATGTGG + Intronic
1102574106 12:113845027-113845049 TGTAATTGGTGCCTGGGCTGAGG + Intronic
1103916671 12:124379309-124379331 TGATGATGGTGCCTAAGCTGGGG - Intronic
1104486133 12:129152544-129152566 TGAGCAGTTTGCCTGGGCTGAGG + Intronic
1104796264 12:131521534-131521556 GGACCACGGTGCCAGTGCTGGGG + Intergenic
1104811095 12:131620932-131620954 TGAAAAGGGTCCCTGGGCTGTGG - Intergenic
1105677487 13:22687969-22687991 TGACCTTGGTCACTTGGCTGAGG + Intergenic
1105985553 13:25562747-25562769 TGCCCAGTGTGCCTGGGCTCAGG + Intronic
1109712570 13:66179996-66180018 TGGCCATGGTGGCAGGGATGAGG - Intergenic
1110530581 13:76592720-76592742 TGAGCATAGTGCTTGTGCTGAGG + Intergenic
1111916230 13:94363592-94363614 TGAGCATGGTTCCTAGGCTAGGG - Intronic
1112204845 13:97314699-97314721 TGACCTCAGTGCCTGAGCTGCGG - Intronic
1113204345 13:107898029-107898051 TGAGCCTGGGGCTTGGGCTGGGG + Intergenic
1113796637 13:113061985-113062007 TGACCCTGGTGCCTGGCCTGGGG + Intronic
1114472515 14:22973593-22973615 TGTCCAAGGTGCCTAGGCTGAGG - Intronic
1117390333 14:55256361-55256383 TGCCCATGGAGCCTGGGGTTTGG - Intergenic
1117786521 14:59291699-59291721 TCACCTTGGTGCATGGGATGGGG - Intronic
1118492506 14:66274888-66274910 TGCCCATGATGCTTGGGGTGAGG - Intergenic
1118717067 14:68567871-68567893 CTACCATAGTGCCTGGCCTGTGG + Intronic
1118894894 14:69937583-69937605 TGAGCCTGGGGCCTGGGCAGCGG + Intronic
1119266232 14:73264632-73264654 TGAGCTGGGTCCCTGGGCTGAGG - Exonic
1119405561 14:74396503-74396525 TGACCAAGGTGCCTGAACTGTGG + Intergenic
1120193223 14:81458535-81458557 TGACAGTGGTGACTGGGCTAGGG - Intergenic
1121602012 14:95212390-95212412 TGCCCATGGTCCAGGGGCTGTGG + Intronic
1121841905 14:97141621-97141643 CCACCATGGTGCCAGGGATGGGG + Intergenic
1122157354 14:99757992-99758014 TGAGCATGGTGCCTGGCATATGG + Intronic
1122458842 14:101879086-101879108 TGGCCAGGCTGCCTGGGGTGCGG - Intronic
1122577237 14:102750093-102750115 TAATCATGGTGCCTCGGCTGTGG + Intergenic
1123570277 15:21598850-21598872 TGAACATTCTGACTGGGCTGAGG + Intergenic
1123606388 15:22034170-22034192 TGAACATTCTGACTGGGCTGAGG + Intergenic
1124499784 15:30217410-30217432 TGACCATGGTGCCTGGGTGTTGG + Intergenic
1124743795 15:32321254-32321276 TGACCATGGTGCCTGGGTGTTGG - Intergenic
1125198117 15:37071974-37071996 CGACTATGGTGCCTGCACTGAGG + Intronic
1125432451 15:39609340-39609362 TGCCCTTGCTGCCTGGCCTGGGG - Intronic
1126163505 15:45634905-45634927 TGACCATGGTGCCTGGGCTGCGG + Exonic
1127391542 15:58508803-58508825 TGACCTTGGTGAAAGGGCTGTGG + Intronic
1128472581 15:67967822-67967844 TGACCCTGTGGCCAGGGCTGGGG - Intergenic
1129180259 15:73869752-73869774 TGACCCAGGAGCCTGGGCTGGGG + Intergenic
1129608873 15:77037881-77037903 GGGCCAACGTGCCTGGGCTGTGG - Intergenic
1129782814 15:78285166-78285188 TGACCTTGTTGCTTGAGCTGTGG - Intronic
1130517289 15:84635593-84635615 TCACCATGTTGCCTAGGCTGGGG + Intergenic
1130536101 15:84786129-84786151 TGCCCACTGTGCATGGGCTGGGG + Intronic
1132030023 15:98431565-98431587 TGGCCTTGGCGCCTGTGCTGTGG - Intergenic
1132041128 15:98525285-98525307 TGGCCCTGGTGCCTGCTCTGTGG - Intergenic
1202978628 15_KI270727v1_random:325941-325963 TGAACATTCTGACTGGGCTGAGG + Intergenic
1132695639 16:1200639-1200661 TGCCCCTGGGGTCTGGGCTGGGG - Intronic
1133228881 16:4356983-4357005 TGACCATGGGGCCCGGGAAGTGG - Intronic
1133467841 16:6045003-6045025 TAGCCATGATGCCTGGGCTGTGG + Intronic
1135503984 16:23020490-23020512 CGCCCATGGTGCCCGGGGTGAGG + Intergenic
1137497215 16:48979823-48979845 TTAGCATGGTGCCTGGCATGTGG - Intergenic
1138051327 16:53781740-53781762 TGATTATGGTGCTTGGTCTGTGG + Intronic
1138442056 16:57041040-57041062 TGATCCTGGTGCCTGGGCCTGGG + Intronic
1139910307 16:70393609-70393631 TGGCCATGGTGTCTGGGGAGGGG + Intronic
1140204524 16:72922562-72922584 TCACCATGGTCCCTGGGTTGAGG - Intronic
1140408141 16:74724672-74724694 TGACCATGATGCCAGTGATGGGG - Intronic
1141312462 16:82927768-82927790 TAGGCAGGGTGCCTGGGCTGAGG - Intronic
1141689246 16:85587178-85587200 AGACCATGGGGTCTGGTCTGGGG - Intergenic
1141798136 16:86288149-86288171 TCACCATGTTCCCTGGCCTGTGG - Intergenic
1141984802 16:87572780-87572802 TGGCCCTGCTGCCTGGGCTGGGG + Intergenic
1142883509 17:2898472-2898494 TGACCCTCATGCCTGTGCTGGGG - Intronic
1143421911 17:6800053-6800075 AGACCATGGGGTCTGGGCTGGGG - Exonic
1144362182 17:14506027-14506049 TAAACAGGCTGCCTGGGCTGAGG + Intergenic
1147388597 17:40095938-40095960 GGCCCATGGGGCCTGGGGTGGGG + Exonic
1147935349 17:44007611-44007633 TGACCATGGAGCCCGTCCTGGGG + Exonic
1148428631 17:47623542-47623564 TGAGCATGGTGCCTGAACTAGGG - Intergenic
1148700447 17:49583558-49583580 TGACCAGGTGGCCTGGGATGAGG - Intronic
1148797998 17:50206458-50206480 TCACCATGTTGGCTAGGCTGGGG - Intergenic
1149599023 17:57881514-57881536 GAAACAGGGTGCCTGGGCTGGGG - Intronic
1151025166 17:70669469-70669491 TGGCCAAGGTGCCTGGCTTGCGG + Intergenic
1151151257 17:72089368-72089390 AGACCACCGTTCCTGGGCTGTGG - Intergenic
1151355584 17:73556046-73556068 TGTCCATGGGGCTTGGGCTTGGG + Intronic
1151425750 17:74030057-74030079 AGACCATGGACCCTGGGATGGGG - Intergenic
1151431604 17:74067290-74067312 TGTCCATAGTGCCGAGGCTGAGG - Intergenic
1151706777 17:75773423-75773445 GGGCCGTGATGCCTGGGCTGTGG + Intergenic
1151876165 17:76869223-76869245 TGACCAGTGGGGCTGGGCTGGGG + Intronic
1151951565 17:77357021-77357043 TCAACCTGGTGGCTGGGCTGTGG + Intronic
1151977733 17:77491983-77492005 AAACCGAGGTGCCTGGGCTGCGG + Intronic
1152021941 17:77784395-77784417 TGGAGATGGTGCCTGGGCTCTGG - Intergenic
1152634933 17:81427028-81427050 TGACCCTGGTGCCCGGGCCAGGG + Intronic
1152699503 17:81812032-81812054 TGAGCCTGGTGCCTGGGGAGGGG + Intronic
1152757400 17:82092693-82092715 TCACCTTGGTGCCTGTGCCGTGG + Exonic
1153354822 18:4123228-4123250 TGACCAGGGAGCCTGGACTCTGG + Intronic
1153583422 18:6598118-6598140 TGATCATGGTCCTTGGCCTGAGG - Intergenic
1155865871 18:30964125-30964147 TAGCCATGCTGCCTGGGCTGTGG - Intergenic
1157089133 18:44614592-44614614 TATCCATGTTGACTGGGCTGAGG + Intergenic
1157333770 18:46722286-46722308 TGGCCAGGCTGCCTGGGCTTGGG - Intronic
1159449690 18:68584361-68584383 TGAGCAGGGTGTCTGAGCTGTGG + Intergenic
1160374142 18:78398178-78398200 GGGCCATGGTGGCTGGGCAGGGG - Intergenic
1160612058 18:80096320-80096342 AGGCCAGGGTGCCTGGGCAGAGG - Exonic
1160696047 19:484971-484993 GCACCACGGGGCCTGGGCTGGGG + Intergenic
1160858358 19:1227366-1227388 TGACGCTGGTGGATGGGCTGTGG - Intronic
1161678913 19:5669199-5669221 TGATGATGGTGCCTGGGCTTTGG - Intergenic
1162180935 19:8868197-8868219 TGACCATGAAGCCTCTGCTGGGG + Intronic
1162379275 19:10322394-10322416 TGGACTTGGTGCCTGGGGTGGGG - Intronic
1162813516 19:13179389-13179411 TCACTCTGTTGCCTGGGCTGGGG + Intergenic
1163267153 19:16228201-16228223 TGATCAAGGTGCGTGGGCCGAGG + Exonic
1163285918 19:16347607-16347629 TGCTCTTGGTGCCTAGGCTGGGG - Intergenic
1163533246 19:17862871-17862893 TGACGGTGTTGCCTGGGCTCTGG - Intronic
1164787044 19:30941767-30941789 TGAGCAAGGGTCCTGGGCTGGGG - Intergenic
1164943885 19:32273882-32273904 AGAACATGGGGCCTTGGCTGCGG + Intergenic
1165232219 19:34394289-34394311 TGATCATGGTGCCCTGGCTAGGG + Intronic
1165312535 19:35037516-35037538 TGCCCATGGTGGCTGGTCTCAGG - Intronic
1166103667 19:40586895-40586917 TGATCTTGGTGACAGGGCTGCGG - Exonic
1167260286 19:48454327-48454349 TGTCCAGCCTGCCTGGGCTGTGG + Exonic
1167854805 19:52228952-52228974 TGCCTATGGTGCTTGAGCTGTGG + Exonic
925290929 2:2748280-2748302 TGACCAGAGTTGCTGGGCTGAGG - Intergenic
925440154 2:3878719-3878741 TGAGCGTGGTTCCTGAGCTGAGG - Intergenic
925747542 2:7056519-7056541 TGAGAATGGTGGGTGGGCTGAGG - Intronic
926145815 2:10396666-10396688 TGTCCATGGTGGCTGGCCGGAGG + Intronic
926228672 2:10986328-10986350 TCACAAGGGGGCCTGGGCTGTGG + Intergenic
926994568 2:18720554-18720576 GGACCATGAGGCCTGGGCTCTGG - Intergenic
927914415 2:26925673-26925695 TGACCCTGGGGCCTGGGCAGGGG - Intronic
928024022 2:27725101-27725123 TGAATATGGTGCCTGGGGAGAGG + Intergenic
930642086 2:53863518-53863540 TCACCATGTTGCCCAGGCTGGGG - Intergenic
931298867 2:60957428-60957450 GCACCACAGTGCCTGGGCTGGGG - Intronic
933089894 2:78106896-78106918 GCACTGTGGTGCCTGGGCTGGGG + Intergenic
934504407 2:94879708-94879730 AGCCCAGGGTGGCTGGGCTGTGG - Intergenic
934691154 2:96360692-96360714 TTACCCTGGTGCCTGGTTTGAGG - Exonic
935743761 2:106173520-106173542 TCACTTTGTTGCCTGGGCTGGGG - Intronic
936479068 2:112868444-112868466 TGACCAGGGTGCCAAGGGTGTGG + Intergenic
938365095 2:130727841-130727863 TGGGCGTGGTCCCTGGGCTGCGG + Intergenic
938627493 2:133126977-133126999 TGAACATTGTTCATGGGCTGAGG - Intronic
939388147 2:141529095-141529117 TGACCGTGAAGCCTGGCCTGTGG + Intronic
942967070 2:181908171-181908193 TCACCATGTTGCCCAGGCTGGGG - Intronic
943320442 2:186436970-186436992 GCACCATGGTGCCTGGGCCAGGG - Intergenic
943408233 2:187515075-187515097 AGACCATGGGGCCCTGGCTGGGG + Intronic
943504119 2:188731649-188731671 TGACCATGGTGTCATGGGTGTGG + Intergenic
943934214 2:193894139-193894161 TCACCATGTTGCCCAGGCTGGGG + Intergenic
944581923 2:201138880-201138902 TGACCATTGGGTCAGGGCTGAGG + Intronic
945974855 2:216262439-216262461 GGACCATGGAGCCCAGGCTGGGG + Intronic
946368597 2:219266548-219266570 TCACCATGCTGCCTGGACAGGGG - Intronic
947467230 2:230362031-230362053 TGACCATGGGCCATGGGCTGTGG - Intronic
947497748 2:230650789-230650811 CGGACATGGTGCCTGTGCTGGGG + Intergenic
947736659 2:232458778-232458800 GGACCAGGGTGCCAGGGATGGGG + Intronic
948045393 2:234939925-234939947 GGACCACCCTGCCTGGGCTGGGG - Intergenic
948459836 2:238123776-238123798 GCACCAGGGTTCCTGGGCTGTGG + Intronic
948496059 2:238350695-238350717 TGCCCATAGTGCCTGGGCGGAGG + Intronic
948757481 2:240167888-240167910 TGGCCGTGATGCCTGGGCTGAGG + Intergenic
949011073 2:241678899-241678921 CCTCCATGGGGCCTGGGCTGTGG - Intronic
1168892972 20:1306494-1306516 TGGCCCAGGAGCCTGGGCTGCGG - Exonic
1169604599 20:7302506-7302528 TTCCCATGGTACCTGGGCTCCGG + Intergenic
1171340082 20:24420672-24420694 TGGCCCAGGTGCATGGGCTGGGG - Intergenic
1171422263 20:25025158-25025180 TCAGCATGTTGCATGGGCTGGGG - Intronic
1172087607 20:32399791-32399813 TCACTCTGTTGCCTGGGCTGGGG + Intronic
1172130338 20:32650769-32650791 TGGCGCTGGTGGCTGGGCTGGGG + Intergenic
1172618966 20:36307173-36307195 TGACCCGGGCACCTGGGCTGGGG + Intronic
1173648773 20:44650250-44650272 TGAGCATTTTCCCTGGGCTGGGG + Intronic
1175196480 20:57247114-57247136 GGCCCTTTGTGCCTGGGCTGGGG - Intronic
1175404408 20:58717212-58717234 TGACCCTGTTGCCAGGGCTCTGG - Intronic
1175915094 20:62422535-62422557 AGGCCATGGGGCCTGGGGTGGGG + Intronic
1177288364 21:19079185-19079207 TGACCAGTGTGCCTGGGATGTGG + Intergenic
1177651843 21:23968208-23968230 TGGCCAAGGTACCTGGGTTGCGG - Intergenic
1179894768 21:44355252-44355274 TGGCCATGTTGCCTGGGCGGGGG - Intronic
1179902935 21:44403147-44403169 TGCCCATGGGGCTGGGGCTGGGG - Intronic
1180010532 21:45047194-45047216 TAAGCATGGTGGCTGGGCGGTGG + Intergenic
1181762380 22:25067300-25067322 TGACAATGGTGACAGGGCAGGGG - Intronic
1182286892 22:29254065-29254087 TGTCCATGGACCCTGGGCTGTGG + Intronic
1182366486 22:29782720-29782742 TGACCCTGAAGGCTGGGCTGTGG + Intergenic
1182382403 22:29903025-29903047 TCACCATGTTGCCTAGGCGGTGG - Intronic
1182694268 22:32186019-32186041 TGACCCTCATGCCTGTGCTGGGG - Intergenic
1183250740 22:36728746-36728768 TGCTCATGGTGCCTGACCTGGGG + Intergenic
1183353068 22:37344288-37344310 TGAGTGTGGTGACTGGGCTGTGG - Intergenic
1183633617 22:39047721-39047743 TCAGCAGGGGGCCTGGGCTGGGG - Intronic
1183665846 22:39245218-39245240 TGTCCATGGTCACTGTGCTGAGG - Intergenic
1183714423 22:39525387-39525409 TGACCAGGGGCCCGGGGCTGGGG + Intergenic
1183817323 22:40313799-40313821 TTAGCATGATGCCTGGCCTGTGG - Intronic
1183907025 22:41049369-41049391 TCGCCATGGTGGGTGGGCTGCGG - Intergenic
1184062372 22:42091196-42091218 AGATAATGGCGCCTGGGCTGCGG + Intergenic
1184066960 22:42126629-42126651 ACACCATGGTGGCTGGGCCGGGG + Exonic
1184339742 22:43879719-43879741 TCACTTTGTTGCCTGGGCTGGGG + Exonic
1184346766 22:43918351-43918373 GGACCATGCTGCCTGGGCAGAGG + Intergenic
1184499404 22:44862747-44862769 TGTCCATGGTTCCTGAGCTGTGG + Exonic
1184516931 22:44968041-44968063 TGACCTTGGTGACCTGGCTGAGG + Intronic
1184773606 22:46612346-46612368 TGACCATGGATGCTGTGCTGTGG + Intronic
1185208952 22:49555847-49555869 ACAGCATGGTACCTGGGCTGGGG - Intronic
949867168 3:8555499-8555521 TGCCCATGGTGCCTGAGCCAGGG - Intronic
949946091 3:9191208-9191230 AGACCATAGTGCCTGGGCCTGGG - Intronic
950374245 3:12557135-12557157 TGCTCATGGTGGCTGGGCTGAGG - Exonic
952151345 3:30595890-30595912 TCACCCTGTTGCCTAGGCTGGGG - Intergenic
953332616 3:42066487-42066509 TGACCTTGCTGCTTGGGGTGGGG - Intronic
953878662 3:46680480-46680502 TGACCATGACCCCTGGGCCGTGG + Exonic
954199373 3:49015081-49015103 AGACCATGATGCTTGGGCTTAGG - Exonic
954208520 3:49079033-49079055 TCTCCATGTTGCCTGGGCTGAGG - Intronic
954219599 3:49144931-49144953 TGAACACGTTGCCTGGGCTGGGG - Intergenic
954461531 3:50629644-50629666 TGTGCATGGTCCCTGGTCTGGGG + Intronic
955133351 3:56191757-56191779 TGAACCTGGTGTCTGGGGTGGGG - Intronic
955645461 3:61132698-61132720 TAACCATGTTGCCTGTGCTGTGG - Intronic
956654557 3:71536386-71536408 TGACTAGGGTGACTGGGGTGTGG - Intronic
956692306 3:71889515-71889537 AGAAGATGGTGGCTGGGCTGGGG + Intergenic
957208428 3:77229627-77229649 TTACTCTGTTGCCTGGGCTGGGG - Intronic
959323145 3:104904374-104904396 CCAGCCTGGTGCCTGGGCTGAGG + Intergenic
960344542 3:116516541-116516563 AGACCAGGGTGCCTGGAGTGCGG - Intronic
960581284 3:119281341-119281363 TGACATTGGTGCCTGGACTAAGG + Intergenic
960599751 3:119444874-119444896 TTACCATGTTGCCCAGGCTGAGG - Intronic
960629191 3:119711963-119711985 TGCTCCTGGTGCCTGGGCAGTGG + Intronic
961328901 3:126127517-126127539 GGAGCATGGAGCCTGGGCAGGGG + Intronic
961644262 3:128384244-128384266 TGCCCAGAGTGGCTGGGCTGTGG + Intronic
961672803 3:128547276-128547298 TAACCATGATCCCTGGGGTGAGG - Intergenic
961789650 3:129366415-129366437 TGCCCTGGCTGCCTGGGCTGCGG - Intergenic
962616937 3:137135686-137135708 TGACCATGGTGCTTTGCCTTGGG + Intergenic
963003767 3:140707097-140707119 TTACCATGGTGGCAGGGGTGGGG + Intergenic
963155178 3:142088526-142088548 TCATCATGCTGCCTAGGCTGGGG + Intronic
967880844 3:194300261-194300283 TCAGCATGGGTCCTGGGCTGCGG - Intergenic
968543105 4:1178243-1178265 AGCCCATGGTGCCTGGCCGGAGG - Intronic
969173864 4:5384692-5384714 AGACCATGGAGTGTGGGCTGGGG + Intronic
970715850 4:18921820-18921842 TGACCATGGGGCCTAAGCTCTGG + Intergenic
970733839 4:19142107-19142129 TGACCTTGGTCCCTGAGCTGAGG + Intergenic
972459179 4:39284368-39284390 TCACTCTGCTGCCTGGGCTGGGG + Intronic
974402783 4:61426660-61426682 TGGCCAAGGTGCCTGGCTTGGGG - Intronic
974610151 4:64206299-64206321 TGCCCATGGAGCCTGGGGTTTGG + Intergenic
976291952 4:83428361-83428383 TCACGATGGTGCCCAGGCTGAGG - Intronic
977833112 4:101617007-101617029 TGGCCATGGTGGCAGGGATGGGG - Intronic
977930286 4:102742986-102743008 TGGCCATGGTGGCAGGGATGGGG - Intronic
979741748 4:124159602-124159624 TGTGCAGAGTGCCTGGGCTGAGG - Intergenic
985573733 5:664138-664160 TGAAGAAGGTGCTTGGGCTGTGG + Exonic
985675484 5:1229474-1229496 GGGCCATTGAGCCTGGGCTGGGG - Intronic
985993127 5:3579682-3579704 CGAGGAGGGTGCCTGGGCTGAGG + Intergenic
986410535 5:7474906-7474928 TGCCCATTGTGGCTGGCCTGGGG - Intronic
992042425 5:72848682-72848704 CGGCCCTGGTGCCTGGGCCGGGG + Intronic
993045497 5:82861561-82861583 TGACCATGGTACATGTGATGTGG + Intergenic
994108529 5:95974139-95974161 TGACCAAGCTGCCTGGACAGTGG + Intergenic
994710129 5:103256314-103256336 TGGCCATGCTGCCTGGGCCCTGG + Intergenic
995164953 5:109028926-109028948 TGCACATGGTGCCTGGTTTGGGG - Intronic
996510946 5:124315257-124315279 TCATTATGTTGCCTGGGCTGGGG - Intergenic
996992322 5:129650195-129650217 TGCCCATGGTGAGTGGGCTGTGG + Intronic
997382019 5:133444955-133444977 TGACCTTGGTGCATAGCCTGTGG + Intronic
997643340 5:135464150-135464172 TGAGGATGGTGCCTGAGATGGGG + Intergenic
998040825 5:138950111-138950133 TGCCCAGGATGCCAGGGCTGGGG + Intronic
999196313 5:149783979-149784001 TGCCCATCTTGCCTAGGCTGGGG - Intronic
999363138 5:151003102-151003124 AAACCACGGTGCCTGGCCTGTGG - Intergenic
1000167248 5:158663952-158663974 TCACCGTGTTGTCTGGGCTGGGG - Intergenic
1001045063 5:168365240-168365262 TGGCCATTGTGCCTGGGCTGGGG + Intronic
1001122480 5:168991872-168991894 TGACCCAGGAGCCTGGGGTGGGG + Intronic
1001744000 5:174076181-174076203 TGATGATGGTGCTTGGGATGTGG + Intronic
1002423867 5:179164589-179164611 TGACCATGTTTCCTGCACTGCGG - Intronic
1002808735 6:604663-604685 GGACCCTGCTTCCTGGGCTGCGG + Intronic
1002853943 6:1021152-1021174 TAAGCATGGTGCCTGGGTTCTGG - Intergenic
1003277685 6:4666360-4666382 TGACCATGGTCACTGTTCTGAGG - Intergenic
1004259690 6:14097252-14097274 TGGCCATGGGGCCTGGCCTAGGG - Intergenic
1004789433 6:19007760-19007782 TGGCCATGGTGCCCTGGATGGGG - Intergenic
1004963005 6:20813230-20813252 GGGCCATGGTGCCTGGCCTCAGG + Intronic
1006137737 6:31906162-31906184 TTACCAGGGTTCCTGCGCTGAGG - Intronic
1006931003 6:37688495-37688517 TGACCTTGGTGGCTGGGTGGTGG - Intronic
1007213371 6:40216397-40216419 TCACCATGGTGCCTGAGCCATGG - Intergenic
1007291841 6:40793489-40793511 TGACCATGATGCCTCTGTTGGGG - Intergenic
1007459600 6:42008455-42008477 TGACAATGGGGACTAGGCTGAGG - Intronic
1007581395 6:42962362-42962384 TGTTCCTGGTGACTGGGCTGGGG - Intronic
1008464748 6:51817850-51817872 TGCCCAGGCTGTCTGGGCTGTGG - Intronic
1009030355 6:58049641-58049663 TGCCCACAGTGCCTGGGGTGGGG - Intergenic
1009205883 6:60800886-60800908 TGCCCACAGTGCCTGGGGTGAGG - Intergenic
1011928036 6:92672713-92672735 TGTCCATGGTGGTTGGGCGGAGG - Intergenic
1012894931 6:104937319-104937341 TGACCATTTTGCCCAGGCTGGGG + Intergenic
1013067224 6:106695497-106695519 TGATCTTGGTGCCTGGACTCAGG - Intergenic
1013985945 6:116193980-116194002 TGATCATGGATCCTGGGCTTAGG - Intronic
1015640671 6:135328077-135328099 TGTGAATGGTGCCTGGGGTGGGG + Intronic
1015948778 6:138530275-138530297 TGACCATGTTGGCAGGGATGTGG + Intronic
1017743139 6:157424845-157424867 TGACTCTGGGGCCTGGGGTGGGG - Intronic
1017826884 6:158088265-158088287 TCACCATGTTGCCCAGGCTGGGG + Intronic
1018735707 6:166685900-166685922 TCACCATGGTGCATTGTCTGCGG - Intronic
1019057522 6:169234054-169234076 GGAACATGGTGCATGGGCAGCGG - Intronic
1019578229 7:1747773-1747795 TGTACATGGGGGCTGGGCTGGGG - Exonic
1019580255 7:1758443-1758465 TGAGGATGGAGGCTGGGCTGAGG + Intergenic
1019580266 7:1758482-1758504 TGAGGATGGAGGCTGGGCTGAGG + Intergenic
1019649273 7:2147792-2147814 TGCCCATGTTGCCTTCGCTGTGG - Intronic
1020013934 7:4820431-4820453 TGTCCATGGGGCCTGGGCCTAGG - Intronic
1020098661 7:5382333-5382355 CCACCATGGGCCCTGGGCTGGGG - Intronic
1020285710 7:6678589-6678611 TGAACAGGGTGGCAGGGCTGAGG + Intergenic
1022834499 7:34101003-34101025 TGATCAGGGGGCCTGGGGTGGGG - Intronic
1023822122 7:43986262-43986284 TGACCACGGTGCCCGGGCTCTGG + Intergenic
1025067821 7:55872864-55872886 TGCCCAAGATGCCTGGCCTGAGG - Intergenic
1026856323 7:73757568-73757590 TGAGCTTGGTGGCTGGGATGTGG + Intergenic
1027684518 7:81265276-81265298 TCACCATGGTGCTTGGGCTGGGG + Intergenic
1027829170 7:83155567-83155589 TGTCCCTGGTGGCTGGACTGGGG + Exonic
1028018416 7:85742777-85742799 TGAGAATGGTGTATGGGCTGGGG + Intergenic
1028832868 7:95345436-95345458 TGACCCTGGTGCCTACTCTGGGG + Intergenic
1029447443 7:100621722-100621744 TGACCTTCGTCTCTGGGCTGTGG - Intronic
1029750388 7:102539676-102539698 TGACCACGGTGCCCGGGCTCTGG + Intronic
1029768340 7:102638784-102638806 TGACCACGGTGCCCGGGCTCTGG + Exonic
1031327725 7:120422712-120422734 TAACCACACTGCCTGGGCTGTGG - Intronic
1032273531 7:130433429-130433451 TGACCCTGCTGTCTGGGCTCTGG - Intronic
1033206571 7:139428275-139428297 TCACCATGTTGCCCAGGCTGGGG + Intergenic
1034210689 7:149359489-149359511 TTACCAGGGTCCCTGAGCTGTGG - Intergenic
1034291727 7:149937830-149937852 TTGCCCAGGTGCCTGGGCTGAGG - Intergenic
1034814358 7:154159068-154159090 TTGCCCAGGTGCCTGGGCTGAGG + Intronic
1035215564 7:157363895-157363917 TGTGCATGGGGCCTGGGGTGGGG + Intronic
1035606455 8:933293-933315 TGGCCATGGTCCCGGGGGTGAGG + Intergenic
1036017298 8:4799397-4799419 TTGCCATGGTGGCCGGGCTGAGG - Intronic
1037678423 8:21072635-21072657 TTAGCATGGTACCTGGGCTATGG + Intergenic
1038006377 8:23434039-23434061 TGACCCTTTTGCCGGGGCTGGGG + Intronic
1038422194 8:27440443-27440465 TGAGCATGGAGTGTGGGCTGTGG + Intronic
1038702479 8:29861713-29861735 TGGGCATGGGGCCTGGGATGCGG + Intergenic
1038914184 8:32001851-32001873 TGACCTTGATCACTGGGCTGAGG + Intronic
1039101720 8:33948560-33948582 TTACCATTGTCCCTGGCCTGTGG - Intergenic
1042065251 8:64867842-64867864 TGAACACGTTTCCTGGGCTGAGG + Intergenic
1042961679 8:74310076-74310098 AGACCATGGAGCCTGGGCTTAGG + Intronic
1043080592 8:75760677-75760699 TCAACATGGTGCTTGGGCTGTGG + Intergenic
1045217003 8:100158407-100158429 AGACCATTGCGGCTGGGCTGTGG + Exonic
1045440089 8:102200592-102200614 AAACCATGATGCCTGGGTTGGGG + Intergenic
1045556037 8:103215499-103215521 TGACCATGGTGGCAGTGGTGGGG - Intronic
1048868222 8:138776382-138776404 TGACCATGGTGCCCAGCCAGGGG + Intronic
1049039892 8:140104702-140104724 CGGGCCTGGTGCCTGGGCTGGGG - Intronic
1049291267 8:141803574-141803596 TGACCTTGGTCCTTGGGCTGAGG + Intergenic
1049330561 8:142048309-142048331 TGAGGATGGTGCCCGGGCCGGGG + Intergenic
1049373389 8:142278175-142278197 TGGACAAGGGGCCTGGGCTGTGG - Intronic
1049541769 8:143211903-143211925 TGACCTTGCAGCCTTGGCTGGGG + Intergenic
1051588153 9:18748731-18748753 TGAGCATGGTGCCTGGGACCTGG - Intronic
1056156793 9:83846037-83846059 TGGCCATGGTGGCAGGGATGTGG + Intronic
1056353743 9:85777489-85777511 TGGCCATGGTGGCAGGGATGTGG - Intergenic
1056939922 9:90946241-90946263 TGGACATGGTGCCTGGACAGTGG + Intergenic
1057811233 9:98258332-98258354 TGAGCATGGTGCCCTGCCTGTGG - Intergenic
1057935444 9:99234720-99234742 TGCTCATGGTGTATGGGCTGTGG + Intergenic
1058683962 9:107464827-107464849 TGACCAGGAAGCCTGGGCTGTGG - Intergenic
1058704795 9:107629319-107629341 ATACCAGTGTGCCTGGGCTGAGG - Intergenic
1059227452 9:112685287-112685309 TCACTATGTTGCCTAGGCTGTGG + Exonic
1059408825 9:114119227-114119249 TGAAGATAGTGCCTGGCCTGAGG + Intergenic
1060114874 9:120932022-120932044 TGACCATGGAGCCATGACTGAGG + Intergenic
1060736610 9:126070246-126070268 TGCCCATGGCGCCAGGCCTGGGG + Intergenic
1060862417 9:126965684-126965706 TTAACATGGTGCCTGGACTGGGG + Intronic
1061482920 9:130906030-130906052 TGACCCCAGTGCCTGGGGTGGGG + Intronic
1061722892 9:132564244-132564266 TGTCCATGGGACCTGGGTTGAGG - Intronic
1062009418 9:134259107-134259129 GGGCCATGGTCCCTGGGCAGGGG + Intergenic
1062282572 9:135758620-135758642 AGGCCACAGTGCCTGGGCTGCGG + Intronic
1062527092 9:136982356-136982378 TGGCCGTGGTGCCAGGGCTCTGG - Intronic
1062566565 9:137166337-137166359 CCACCATGGTGCCTGGGCCTGGG - Intronic
1192151042 X:68712612-68712634 TGATCCTGGTTCCTGGGCAGGGG + Intronic
1192427306 X:71088731-71088753 TCACCATGTTGCCCAGGCTGAGG + Intergenic
1193745042 X:85267387-85267409 TGTCCCTGTTGTCTGGGCTGCGG + Intronic
1194149889 X:90310620-90310642 TAACAATGATGTCTGGGCTGAGG - Intergenic
1194516032 X:94855085-94855107 AGAGCATGGTGCCTCTGCTGTGG + Intergenic
1195752679 X:108174151-108174173 AGGAGATGGTGCCTGGGCTGGGG + Intronic
1196457069 X:115898396-115898418 TGGCCAAGGAGCCTGGGCTCAGG - Intergenic
1197787237 X:130211149-130211171 TCACCATGGTGCCTATTCTGAGG - Intronic
1198756172 X:139985062-139985084 TGACCATGGTGGTAGAGCTGGGG - Intergenic
1200496315 Y:3887695-3887717 TAACAATGATGTCTGGGCTGAGG - Intergenic
1202042227 Y:20697639-20697661 TGGTCAGGGTGCCTGTGCTGTGG + Intergenic