ID: 1126163507

View in Genome Browser
Species Human (GRCh38)
Location 15:45634911-45634933
Sequence TGGTGCCTGGGCTGCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 297}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163495_1126163507 28 Left 1126163495 15:45634860-45634882 CCTGGTTCTGTGCCCCGTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 20
4: 297
1126163499_1126163507 14 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 20
4: 297
1126163496_1126163507 16 Left 1126163496 15:45634872-45634894 CCCCGTGAGCGCTCAACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 20
4: 297
1126163500_1126163507 -2 Left 1126163500 15:45634890-45634912 CCCTGGTGTGTTCACTGACCATG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 20
4: 297
1126163497_1126163507 15 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 20
4: 297
1126163501_1126163507 -3 Left 1126163501 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 20
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163507 Original CRISPR TGGTGCCTGGGCTGCGGCGC CGG Exonic
900110468 1:1003333-1003355 TGGATCCTGGGCTGCAGCCCAGG + Intergenic
900159664 1:1217475-1217497 TGGTGCGTGGGGGGCGGCGCGGG + Exonic
900386124 1:2411912-2411934 AGGGGCCTGGGCTGCTGCTCAGG + Intronic
900970903 1:5992075-5992097 CGGTGCCTGGGGTGCGGCGGTGG - Intronic
901022311 1:6261450-6261472 TGGGGCCAGGGCTGGGGCTCAGG + Intergenic
902350111 1:15847968-15847990 GGGTGCCGGGGCGGCGGCGGCGG - Exonic
902410216 1:16207823-16207845 TGGGGCCTGGGCCCCGGCCCAGG + Intronic
902410217 1:16207828-16207850 GGGTGCCTGGGCCGGGGCCCAGG - Intronic
902691182 1:18110809-18110831 TGGAGCCTGTGCAGTGGCGCCGG + Intronic
903070496 1:20724696-20724718 TGGTGAGTGGGCTGAGGCCCAGG - Intronic
904442117 1:30538859-30538881 TGGTCCCTGGGCTGAGATGCTGG - Intergenic
905204852 1:36337588-36337610 TGGTGCCTGGACTGTGGCAGGGG + Intergenic
905629323 1:39510136-39510158 AGGAGCCTGGGCTGCGCCTCTGG - Intronic
905668435 1:39776057-39776079 AGGAGCCTGGGCTGCGCCTCTGG + Intronic
905819758 1:40980112-40980134 CGGGGCCTGCGCTGCCGCGCTGG + Intronic
905947738 1:41917939-41917961 TGCTGCCTTGGCTGCTGCTCCGG - Intronic
906295433 1:44646397-44646419 TGATGTATGGGCCGCGGCGCAGG + Intronic
906698371 1:47840046-47840068 TGGGGCCTGGGGTGCAGCCCAGG + Intronic
908360213 1:63361627-63361649 TGTTGCCTAGGCTGGAGCGCAGG - Intergenic
912934744 1:113993433-113993455 TGGAGCCTGGGCTGTGATGCTGG + Intergenic
915124643 1:153655252-153655274 TGTTGCCTGGGCTGAAGTGCAGG - Intergenic
915145370 1:153793501-153793523 TGGTGCTGGGGCTGCTGGGCTGG + Intergenic
915204177 1:154257188-154257210 TGCTGCCTAGGCTGAGGCCCAGG - Exonic
915511348 1:156388569-156388591 TTGTTCCTGGGCGGCGGCGGCGG - Intergenic
918175467 1:182040597-182040619 TGGGGCCTGGGCAGCGGCTGTGG + Intergenic
918314152 1:183308903-183308925 TGGTGGCATGGCTGCAGCGCTGG + Intronic
919767212 1:201135170-201135192 TGGGGCTGGGGCTGAGGCGCTGG + Exonic
919810573 1:201406675-201406697 TGGGGCCTGGGCTGGGGGCCTGG - Exonic
921171985 1:212558589-212558611 TGGCGGCTGGGGTGCGGTGCGGG - Intergenic
922228971 1:223669077-223669099 TGGTGCCTGGGGTGTGAGGCTGG - Intergenic
924624558 1:245688105-245688127 AGGAGCCTGGGCCGCAGCGCCGG + Exonic
1063415597 10:5870356-5870378 TGGTGCCCGGGCAGAGTCGCAGG - Intronic
1063652431 10:7951406-7951428 TGGTGCTTTGGCTGGGGCTCTGG + Intronic
1064672445 10:17730792-17730814 TGGTGACTGGGATGCCGGGCTGG + Intergenic
1066370173 10:34814057-34814079 ATGTGGCTGGGCTGCGGGGCCGG - Intronic
1069487889 10:68836568-68836590 TGGGACCTGGGCTGAGGCACAGG - Intronic
1069830415 10:71279296-71279318 AGGAGCCAGGGCTGCGGGGCAGG - Intronic
1070868941 10:79731101-79731123 TGGTGCCTGGGCTTCCTTGCTGG - Intergenic
1071635854 10:87253283-87253305 TGGTGCCTGGGCTTCCTTGCTGG - Intergenic
1071659387 10:87484656-87484678 TGGTGCCTGGGCTTCCTTGCTGG + Intergenic
1073476631 10:103757867-103757889 CTGTGCCTGGGCTGCGGCCTGGG + Intronic
1075501727 10:122980711-122980733 CGGGGCCTGGGCCGCGGGGCGGG + Intronic
1076175205 10:128362987-128363009 TGGTGGTTGGGCTGCAGCGAGGG + Intergenic
1076294923 10:129376744-129376766 GGGGGCCTGGGATGCGGAGCAGG + Intergenic
1076579294 10:131496036-131496058 TGGTGCCTCGACTGCCGCACAGG - Intergenic
1076658169 10:132037812-132037834 AGTTGCCTGGGCCGCAGCGCAGG + Intergenic
1077052802 11:575436-575458 GGCTGCCTGGGCTGGGGCCCGGG - Intergenic
1081534933 11:43989609-43989631 TGGTGCCTGGGCTGGGAACCAGG - Intergenic
1081938143 11:46918601-46918623 GGTGGCCGGGGCTGCGGCGCGGG - Exonic
1083292470 11:61697503-61697525 AGGAGCCTGGGCTGTGGGGCAGG + Intronic
1083328240 11:61884612-61884634 GGGAGCCTGGGCTGGGGGGCAGG + Intronic
1083393854 11:62374916-62374938 AGGTGCCTGGGCTGCGTTCCAGG - Intronic
1083997750 11:66280511-66280533 TGGGGCCTGGGCTGAGGGTCTGG - Intronic
1084168208 11:67387009-67387031 TGGCCCCTGGGCTGTGGGGCTGG - Intronic
1084412783 11:69013870-69013892 TGGTGCCTGCGCTGCTCAGCGGG + Intergenic
1085519372 11:77129197-77129219 TGGTGCCCAGGCTGTGGAGCAGG - Intronic
1085561052 11:77473490-77473512 GGCTGCCAGGGCTGGGGCGCGGG - Intronic
1089318970 11:117612305-117612327 TGTTGCCTGGGTTCCGGCGTGGG - Intronic
1089366835 11:117925831-117925853 TGGGCCCTGGGCTGGGGAGCTGG - Intronic
1090235195 11:125141850-125141872 TTGTGACTGGGCTGGGGGGCTGG + Intergenic
1091759857 12:3079808-3079830 TGTTGCCTGGGCTGGAGCACAGG + Intronic
1092124566 12:6066139-6066161 TGGGGCCTAGGCTGGGGCGTGGG - Intronic
1092250260 12:6891151-6891173 TGGCACCTGGGCGGCTGCGCGGG - Intronic
1095990311 12:48029879-48029901 TGATGCATGGGCTGAGGCGAAGG - Intergenic
1097157810 12:57025662-57025684 TGGTGCCAGGGCTTGGGAGCAGG - Intronic
1099095487 12:78370339-78370361 TGGTTCCTGGGCTGCTGTGGTGG - Intergenic
1100559797 12:95736822-95736844 TGCTGGCTGGGCTGAGTCGCTGG - Intronic
1104093931 12:125538972-125538994 TGGTGGCTGGGCTCGGGTGCTGG - Intronic
1104280622 12:127373286-127373308 TGGTGGCTGGGCTCCGCTGCTGG + Intergenic
1105217486 13:18297624-18297646 TGGTGGCCGGGCAGCGGCGGCGG + Intergenic
1105525702 13:21176327-21176349 CGGTGCGTGGGGTGCGCCGCGGG - Intronic
1112271823 13:97976247-97976269 TGGGGCCAGGGCTGCGTCGCGGG - Intronic
1112451947 13:99520531-99520553 TGCTGCCTGGGCTCCCGCACTGG + Intronic
1112768673 13:102773330-102773352 CGCTGCCGGGGCTGCGCCGCGGG + Intronic
1113655818 13:112067366-112067388 GGGCGCCTGGGCTGCGGTGGCGG + Intergenic
1115169544 14:30488825-30488847 TGCTGCCAGGGCTGGGGCGAAGG + Intergenic
1117978820 14:61322078-61322100 CGGGGCCGGGGCAGCGGCGCCGG + Exonic
1118854787 14:69612139-69612161 TGCTGCCCGGGCAGCGACGCGGG - Intronic
1121012924 14:90532705-90532727 AGGTACCTGGGCTGGGGAGCTGG - Exonic
1122022757 14:98852798-98852820 TCATGCCTGGGCTGGGGGGCGGG + Intergenic
1122616367 14:103020604-103020626 TGGTCCCTGGGGTGCTGCTCTGG - Intronic
1122746368 14:103899430-103899452 TGGTGCTTGGGCTGCGGGGAAGG + Intergenic
1126099663 15:45111701-45111723 TGGGGCCTGGGCTTCGGGCCTGG - Intronic
1126163507 15:45634911-45634933 TGGTGCCTGGGCTGCGGCGCCGG + Exonic
1127144102 15:56007270-56007292 TGGTGCTGGTGCTGCGGCGGCGG + Intergenic
1129468786 15:75738771-75738793 TGGAGCGCGGGCTGCGGGGCGGG - Intergenic
1130270747 15:82445716-82445738 TGGAGCGTGAGCTGCGGCGGGGG - Intergenic
1130463091 15:84173039-84173061 TGGAGCGTGAGCTGCGGCGGCGG - Intronic
1130489583 15:84421749-84421771 TGGAGCGTGAGCTGCGGCGGCGG + Intergenic
1130501174 15:84500511-84500533 TGGAGCGTGAGCTGCGGCGGCGG + Intergenic
1130508693 15:84570612-84570634 TGGAGCCTGAGCTGCCGCGGCGG + Intergenic
1131366535 15:91846407-91846429 TGGTCCCTGGGCAGCAGCACAGG - Intergenic
1131369495 15:91867794-91867816 TGGTGACTGGGCGGAGGCCCCGG + Intronic
1132574884 16:659732-659754 CGGGGCCTGGGCTGCGGCAGTGG + Intronic
1132581056 16:684819-684841 TGGTGCCAGGGCTGCAGCCACGG - Exonic
1132594319 16:741237-741259 CGGGGCCGGAGCTGCGGCGCTGG - Intronic
1132722530 16:1323788-1323810 TGGGGTCTGGGCTGCGGTCCAGG + Intronic
1132835577 16:1951261-1951283 AGGTGCCTGGACTGCAGGGCTGG - Intronic
1132871263 16:2116743-2116765 TGGAGCCTGGGCTGAGGAGGAGG - Intronic
1132930274 16:2455498-2455520 TGGAGCCTGGACTGCTGCTCTGG + Exonic
1132998462 16:2836631-2836653 TGGTGCCTGGGCCGGGGGGTGGG - Intronic
1133301226 16:4783974-4783996 GGGTGTCTGGGATGTGGCGCTGG + Exonic
1134265746 16:12691090-12691112 TGGGGCCTGGGCAGTGGCCCTGG - Intronic
1134521263 16:14920151-14920173 TGGAGCCTGGGCTGAGGAGGAGG + Intronic
1134708938 16:16318802-16318824 TGGAGCCTGGGCTGAGGAGGAGG + Intergenic
1134716148 16:16358836-16358858 TGGAGCCTGGGCTGAGGAGGAGG + Intergenic
1134950667 16:18349843-18349865 TGGAGCCTGGGCTGAGGAGGAGG - Intergenic
1134958605 16:18393323-18393345 TGGAGCCTGGGCTGAGGAGGAGG - Intergenic
1136365395 16:29806984-29807006 TGGGGCGTGGGCGGGGGCGCCGG - Exonic
1137479526 16:48840188-48840210 TGGTGCATGGTCTGGGGCTCTGG - Intergenic
1138247655 16:55479384-55479406 TGGAGCCTGCTCCGCGGCGCAGG - Exonic
1138347028 16:56326382-56326404 TGGTGCCTGGGCTGAGACAGGGG + Intronic
1141218184 16:82044449-82044471 TGGGGCCTGGGCTGGGCAGCTGG + Intronic
1142032625 16:87846115-87846137 TGGAGCCAGGGCTGCGGCGTTGG - Intronic
1142049938 16:87951622-87951644 CGGCGGCGGGGCTGCGGCGCGGG - Intronic
1142136395 16:88453719-88453741 TGGCGGCTGGGCTCCGGCGGGGG - Intronic
1142188600 16:88706582-88706604 TCTTACCTGGGCCGCGGCGCCGG - Exonic
1142408838 16:89906008-89906030 TGGTCCCTGGCCTGCGGCTGGGG - Intronic
1142868216 17:2804158-2804180 GGGAGCCTGGGCTGCAGCCCAGG - Intronic
1144958702 17:19032862-19032884 TGGTGGCTGGGCTGGGGGGGTGG + Intronic
1144961152 17:19044888-19044910 TGGAGACTGGGCTGGGGAGCAGG + Intronic
1144974009 17:19129636-19129658 TGGAGACTGGGCTGGGGAGCAGG - Intronic
1144976457 17:19141662-19141684 TGGTGGCTGGGCTGGGGGGGTGG - Intronic
1145997188 17:29111518-29111540 TGGTGCCATGGCTGTGGCCCAGG + Exonic
1146257263 17:31398820-31398842 TGCTGCCTGGGCTGGTGGGCGGG + Intronic
1147388600 17:40095944-40095966 TGGGGCCTGGGGTGGGGTGCTGG + Exonic
1147969164 17:44210529-44210551 GAGCGCCTGGGCTGCTGCGCGGG - Intronic
1147969201 17:44210667-44210689 CGGTGCCTGGGCTGGGACGTGGG - Intronic
1148607248 17:48939495-48939517 TGTTGCCTGGGCTGTTGTGCAGG + Intronic
1148629063 17:49092601-49092623 AGGTGCCTGGGCTGGGGCGGGGG + Intergenic
1148997447 17:51723461-51723483 TGGTGCCTGGGATGTGGTGATGG + Intronic
1152294541 17:79459072-79459094 GTGTGCCTGGGCTGCAGAGCTGG - Intronic
1152357482 17:79813924-79813946 TGGTGCTGGGGCTTGGGCGCGGG - Intergenic
1152920508 17:83064271-83064293 TGGTGCAGGGGCTGCAGGGCTGG - Intergenic
1153052188 18:909447-909469 GGGAGCCTCGGCGGCGGCGCGGG + Exonic
1154268214 18:12897122-12897144 TGGTGCCGCGGCGGCGGCGGCGG - Intronic
1155954074 18:31942761-31942783 CGCTGCCTGTGCTGCGGCGATGG - Exonic
1155996021 18:32332359-32332381 TGGGGGCTGGGCTGCGTCTCTGG - Intronic
1159020302 18:63137868-63137890 TGGTGCCTGTGGTGCAGGGCAGG + Intronic
1159586832 18:70289520-70289542 CGAGGCCTGGGCAGCGGCGCGGG + Intronic
1160345228 18:78127175-78127197 TGGGGCTTGGGCAGCGGCGAGGG + Intergenic
1160510678 18:79451841-79451863 TGCGGCCTGGGCTTCGGCGCTGG + Intronic
1160763555 19:797541-797563 CGGGGGCAGGGCTGCGGCGCGGG - Intronic
1160951973 19:1672074-1672096 GGGTGCATGGGGTGGGGCGCGGG + Intergenic
1161056158 19:2191581-2191603 TGGGGCCCGGGCTGGGGCCCAGG - Intronic
1161062977 19:2224270-2224292 TGGTGCCTGGGCGGAGGTGCTGG + Intronic
1161218634 19:3107487-3107509 TGGGGCCTGTGCTGGGGTGCAGG + Intronic
1161366863 19:3885063-3885085 TGTTGCCTGGGCTGGAGTGCAGG - Intronic
1161479195 19:4502253-4502275 GGGGGCCTGAGCTGGGGCGCAGG + Exonic
1161495613 19:4584362-4584384 TGCGGCCCGGGCTGCGGCCCCGG + Intergenic
1161574955 19:5049948-5049970 TGGTCCCTGGGCTGGGGTTCAGG + Intronic
1162794455 19:13079291-13079313 TGGTACCTGGGCTGCTCCCCAGG + Intronic
1163443060 19:17331271-17331293 TGCTGCCTGGGCTGGGGGGTGGG - Intronic
1163672358 19:18636655-18636677 TGGTCCCTGGGCTGAGGAGTGGG - Intergenic
1164051185 19:21586728-21586750 GGCTGGCTGGGCAGCGGCGCTGG + Intergenic
1164455171 19:28400647-28400669 TGGTGGGTGGGCTGGGGCTCAGG - Intergenic
1164633024 19:29774061-29774083 TGGAGCCTGGCCTGTGGGGCAGG - Intergenic
1165353571 19:35290769-35290791 TGGTGCCTGGGCTTTGGTGGTGG - Intergenic
1165459593 19:35936664-35936686 GGCTTCCTGGGCTGCGGCGGAGG - Intronic
1165953867 19:39489624-39489646 TGGTCCCTGGGCTGAGGCCTGGG + Intronic
1166103827 19:40587864-40587886 TGTTGCCTGGGCTGGAGTGCAGG - Intronic
1166111447 19:40625765-40625787 GGGTGCCTGGGCTGCTCAGCAGG + Intronic
1166270005 19:41707979-41708001 TGTTGGCTGAGCTGCGGCTCAGG - Intronic
1166910183 19:46148926-46148948 TAGTGCCTGGGCTACAGGGCTGG - Exonic
1167074271 19:47239545-47239567 TGGGGGCTGGGCGGGGGCGCGGG + Intergenic
1168081233 19:54012061-54012083 TGGTCCCTGGGCTGCGGCGTGGG + Exonic
1168685677 19:58347731-58347753 TGAAGCCGGGGCTGAGGCGCAGG - Intronic
927888885 2:26736044-26736066 TTGTGACTGGGCTGCAGCCCTGG - Intergenic
927894717 2:26774356-26774378 TGGCGCCTGGTCTGAGGCCCGGG - Intronic
930418576 2:51120757-51120779 TGGTACCTGGACTGAGGCCCAGG + Intergenic
931587282 2:63841729-63841751 TGGGGCCTGGACGGCGGCGCGGG + Exonic
934296819 2:91749027-91749049 TGGTGGCCGGGCCGCGGCGGCGG - Intergenic
937321229 2:120961986-120962008 AGGAGCCTGGGCTGAGGGGCAGG - Intronic
937997083 2:127702129-127702151 GGTCGCCTGGGCCGCGGCGCCGG + Exonic
938086420 2:128405044-128405066 TGGTGGCTGTGCTGGGGCTCTGG + Intergenic
938090004 2:128425211-128425233 TGCTCCCTGGGCGGCGGCACAGG + Intergenic
940293469 2:152099126-152099148 GGGAGCCTGGGCGCCGGCGCGGG - Intergenic
940657271 2:156503093-156503115 TGGTGCCTTGGCTGTGGTGCTGG + Intronic
948179250 2:235966690-235966712 TGCTGCCTGGGCTGCCCTGCAGG + Intronic
948415425 2:237799217-237799239 TGGAGCCTCTGCTGCGGGGCGGG + Intronic
1169758842 20:9069165-9069187 TGCTGCCGGGGATGCGGCGACGG - Intronic
1171355913 20:24545262-24545284 TGATGCCTGGGCATCTGCGCAGG + Intronic
1171460507 20:25295510-25295532 TGGTGCCTGGCCTCCTGCCCTGG + Intronic
1172274943 20:33674288-33674310 TGGGGCTGGGGCTGGGGCGCGGG + Exonic
1172570511 20:35966738-35966760 TGGTCCCTGGGCTAAGGTGCTGG + Intronic
1173864474 20:46305528-46305550 TGGTGTCTGGGCTGAGGCCCCGG - Intronic
1174809521 20:53633813-53633835 TGATGCCTAGGCTGCGGTGCAGG + Intergenic
1175160023 20:57001493-57001515 TGGTGCCGAGGCTGCTGCTCTGG - Intergenic
1175392852 20:58637947-58637969 TGGTGGCAGGGCTGAGGCTCAGG - Intergenic
1175423865 20:58852444-58852466 TGGTGCCTGGGAAGGGGCGCAGG - Intronic
1176085566 20:63294074-63294096 TGGTGCGTGGGGTGAGGGGCTGG + Intronic
1176089722 20:63313469-63313491 TGCTGCCTGGGCTGCCCTGCGGG - Intronic
1176117931 20:63441176-63441198 TGGGGCCTGGCCTGCGGGGGAGG + Intronic
1176410306 21:6446169-6446191 TGGAGCCTGGCCTGGGGCCCAGG - Intergenic
1178511839 21:33211892-33211914 TGGTGCCTGGGCGGGGGTGGAGG - Intergenic
1179685799 21:43054491-43054513 TGGAGCCTGGCCTGGGGCCCAGG - Intronic
1179714888 21:43281528-43281550 TGGTGCCGGGGCTGTGGTGCTGG + Intergenic
1179889867 21:44330096-44330118 TGGGGCCGGGGCTGCGGCCATGG + Exonic
1179960043 21:44762967-44762989 TCGCGCCTGGGCTGCTCCGCAGG - Intergenic
1180167783 21:46038975-46038997 TGCGGCCTGGGTTGCAGCGCAGG - Intergenic
1180949320 22:19714218-19714240 CTGGGCCTGGGCTGCGGCACCGG + Intergenic
1181031036 22:20149018-20149040 AGGGGCCAGGGCTGCGGTGCGGG - Intronic
1181512290 22:23394384-23394406 AGGGGCCAGGGCTGCGGTGCGGG + Intergenic
1181613897 22:24038500-24038522 TAGTGCATGGGCTGTGGGGCTGG + Intronic
1182288397 22:29260922-29260944 TGGGGCCTGGCCTGTGGCGTGGG - Intronic
1183530402 22:38350378-38350400 TGTTGCCTGGGCTGGAGGGCTGG + Intronic
1183536015 22:38401847-38401869 TAGTGCCTGGCCTGCGACCCAGG - Intergenic
1183686455 22:39363783-39363805 TGGTCCCTGCCCTGCGGTGCAGG - Intronic
1183942067 22:41301612-41301634 AGCTGCCGGGGCGGCGGCGCCGG + Exonic
1184412185 22:44331741-44331763 TGGGGCCGGGGCTGCAGCTCCGG + Intergenic
1184513744 22:44947578-44947600 TGGTGCCTGTGCTGCCGAGCGGG - Intronic
1185289747 22:50017402-50017424 TGCTACCTGGCCTGCTGCGCTGG - Intronic
1185337049 22:50275368-50275390 TGGTGCGTGGGCGGAGGCGGAGG + Exonic
950066482 3:10115864-10115886 AGGTGGTTGGGCTGGGGCGCCGG + Intronic
950710538 3:14810492-14810514 TGGAGGCGCGGCTGCGGCGCAGG + Intergenic
952451775 3:33440106-33440128 CGGGGGCTGGGCGGCGGCGCCGG - Exonic
954382577 3:50227476-50227498 GCGGGCCTGGGGTGCGGCGCGGG - Intronic
954392832 3:50276345-50276367 TGCTGCGCAGGCTGCGGCGCCGG + Exonic
954461532 3:50629650-50629672 TGGTCCCTGGTCTGGGGCACTGG + Intronic
955215614 3:56982869-56982891 GGTTGCCTGGACTGCGGGGCTGG - Intronic
955484573 3:59422986-59423008 TGGTCCCTGGGCAGTGGGGCTGG - Intergenic
956979055 3:74614881-74614903 AGGGCCCTGGGCGGCGGCGCGGG + Intergenic
960629194 3:119711969-119711991 TGGTGCCTGGGCAGTGGTGGAGG + Intronic
962919122 3:139935376-139935398 TGCTGCCTGGGCGGCTGTGCTGG + Exonic
966874519 3:184314758-184314780 GGGCGCCGGGGCGGCGGCGCAGG - Intronic
966895514 3:184441788-184441810 TGGTGCCTGGGCTTCTGTGAAGG + Intronic
966914489 3:184577368-184577390 TGCTGCCTGAGCTGCTGTGCAGG - Exonic
968604899 4:1530501-1530523 TGGTGCTGGGGCTGGGGCTCTGG + Intergenic
968960992 4:3743589-3743611 TGTGGCCTGAGCTGCGGTGCAGG + Intergenic
969115013 4:4865973-4865995 TCGCACCCGGGCTGCGGCGCAGG - Intergenic
969390927 4:6890858-6890880 TGGTTTCTGGGCTGGGGCACTGG + Intergenic
969509997 4:7612356-7612378 GGGTGCCTGGGATGTGGCGGAGG - Intronic
970733841 4:19142113-19142135 TGGTCCCTGAGCTGAGGCTCTGG + Intergenic
975778972 4:77819646-77819668 TGGTGCTGGTGCTGCGGCGGCGG + Intergenic
975801081 4:78059154-78059176 TGGTGCCTAGGAAGGGGCGCGGG + Intronic
976743260 4:88378771-88378793 TGGGGCCAGGGCTGCGCCCCTGG + Intronic
980405077 4:132344925-132344947 TGGGGCCGGGGCTGCGGCTGGGG + Intergenic
981049398 4:140295586-140295608 TGCTGGCTGGGCTCCGGCTCAGG + Intronic
985580469 5:693170-693192 GGGGGCAGGGGCTGCGGCGCAGG + Intronic
985595128 5:784560-784582 GGGGGCAGGGGCTGCGGCGCAGG + Intergenic
985811701 5:2094878-2094900 TGGTGACTGGGCCACGGCGCTGG - Intergenic
985993129 5:3579688-3579710 GGGTGCCTGGGCTGAGGAGAGGG + Intergenic
986132226 5:4942350-4942372 TGCAGCCTGGGCAGCCGCGCGGG - Intergenic
986727663 5:10611550-10611572 TGGTGTCTGACCTGCGGTGCTGG + Intronic
988864937 5:35324427-35324449 TGGTGCATGGGCTGCCCCACTGG - Intergenic
992627538 5:78648836-78648858 TGGTGACTGGGCAGCGGCGCGGG - Intronic
995199349 5:109409692-109409714 TTGTCCCTGGCCTGCTGCGCCGG - Intronic
995725469 5:115177611-115177633 TAGTGCTGGGGCTGCGGGGCGGG + Intronic
998331676 5:141332819-141332841 TGGCGCACAGGCTGCGGCGCTGG + Exonic
998332504 5:141341106-141341128 TGGCGCACAGGCTGCGGCGCTGG + Exonic
998333060 5:141346168-141346190 TGGCGCTCAGGCTGCGGCGCTGG + Exonic
998337407 5:141385034-141385056 TGGCGCTCAGGCTGCGGCGCTGG + Exonic
998340755 5:141415322-141415344 TGGCGCACAGGCTGCGGCGCTGG + Exonic
998342840 5:141432894-141432916 TGGCGCTCAGGCTGCGGCGCTGG + Exonic
999616457 5:153429953-153429975 TGGTGTCAGGACTGCGGCCCAGG - Intergenic
1001035170 5:168292050-168292072 TGGTGCCTCGGCGGCCGCCCGGG + Intronic
1001037150 5:168305412-168305434 TGGAGCCTGGGCTGGGGAGGTGG - Intronic
1002160434 5:177311434-177311456 TGGGGCCTGGACTGCGATGCGGG + Exonic
1002518165 5:179774561-179774583 TGGTGCTGGGGCAGGGGCGCTGG - Exonic
1003960013 6:11200109-11200131 TGGTGCCTGGGAGGCTGTGCTGG + Intronic
1004171223 6:13296985-13297007 TGCTGCCTGGGCTGCCTCCCCGG + Intronic
1007476212 6:42121717-42121739 TGGAGCCTGGTCTGGGGCACTGG + Intronic
1007660354 6:43481196-43481218 TGGTGCATGGGCTGTGGTGAGGG + Intronic
1008885709 6:56430168-56430190 AGGTGCCTGGGCTGCGTTCCAGG + Intergenic
1014019451 6:116571132-116571154 TGGTGGCCGGGCTGGGGCGAGGG - Intergenic
1016949381 6:149565833-149565855 TCCAGCCTGGGCTGCGGCTCGGG - Intergenic
1018458344 6:163972648-163972670 TGAAGCCTGCGCAGCGGCGCTGG + Intergenic
1019536217 7:1531052-1531074 AGGTGCCCGGGCCGCGCCGCGGG - Intronic
1019624473 7:2009027-2009049 CGGTGCCAGGGTTGCGGGGCCGG - Intronic
1019927767 7:4204684-4204706 TGCCGCCGGGGCTGCGGCCCAGG - Intronic
1020280454 7:6647583-6647605 TGGGGCCTGGCCTGGAGCGCAGG - Intronic
1020760505 7:12262910-12262932 TGGGGCCTCGGCTGAGGCTCTGG - Intergenic
1021600212 7:22356946-22356968 GGGCGCTGGGGCTGCGGCGCAGG + Intronic
1023703061 7:42911775-42911797 TGGTCCCTGAGCCGCGGCGCTGG - Intronic
1029278116 7:99419656-99419678 TGGGGCCTGGGCCGCCCCGCCGG - Exonic
1033477132 7:141702038-141702060 TGGGGCCGGGGCGGCGGCGGGGG - Exonic
1034531003 7:151696499-151696521 TGGCGTCAGGGCTGAGGCGCCGG - Intronic
1034964733 7:155384066-155384088 GGGTGTCTGGTCTGCGGAGCAGG + Intronic
1034968463 7:155405255-155405277 TGGGGCCGGGGCAGCGGGGCAGG - Intergenic
1035027122 7:155833359-155833381 TGGAGGGGGGGCTGCGGCGCAGG + Intergenic
1035168545 7:157005536-157005558 TGGTGGCTGGGCCGCGGGGGCGG + Exonic
1035464305 7:159064740-159064762 TGGTGCCAGAGCTGGGGCGAAGG - Intronic
1038450599 8:27636760-27636782 GGCTGCATGGGCTGCGGGGCTGG + Intronic
1039517431 8:38145587-38145609 TGGTGGCTGGGCTGGGGCCTTGG + Intronic
1042040217 8:64581382-64581404 GGGGGCCTGGGCGGCGGCGGCGG + Exonic
1044618410 8:94165568-94165590 TGGTGCCTGAGCTGCAGCTCCGG + Intronic
1049039889 8:140104696-140104718 TGGTGCCTGGGCTGGGGGAATGG - Intronic
1049091247 8:140515477-140515499 TGGTGCCTGAGCTGCAGGGTGGG - Exonic
1049302743 8:141880296-141880318 TGGAGGCTGGGCTGCTGCCCTGG - Intergenic
1049337361 8:142093580-142093602 TGGTGCCTGGGATGGGGCAGAGG - Intergenic
1049470187 8:142771842-142771864 TGGGGGCAGGGCTGCGGCCCTGG - Intronic
1049582790 8:143420432-143420454 TGGTGACTGGGCCGGGGGGCTGG + Intronic
1049642243 8:143720958-143720980 TGGGGCCCGGGCTGCGGCCAAGG - Intronic
1055566182 9:77570402-77570424 TGTTGCCTGGGCTGCAGTGGTGG - Intronic
1056666759 9:88587562-88587584 TGGTGCCTGGGCTCCATCACTGG - Intergenic
1056834756 9:89945368-89945390 TGGTGACTGGGCAACGGGGCAGG - Intergenic
1057219335 9:93247642-93247664 TGCTCCTTGGGCTGCAGCGCGGG - Exonic
1057432232 9:95004943-95004965 CGGGGCCTGGGCGGCGGCGCGGG - Intronic
1057508092 9:95652994-95653016 TGGTGCCCGGCCTGCAGCACTGG - Intergenic
1057619164 9:96619605-96619627 TGTAGCGAGGGCTGCGGCGCCGG - Exonic
1058933404 9:109745003-109745025 TGGTGCCTGGGCTGAGAAGAAGG - Intronic
1058936184 9:109771800-109771822 TGCTCCCTGGGCTGCGACCCAGG - Intronic
1060821750 9:126665299-126665321 TGGAGCCAGGGCTGGGGCGGCGG + Intronic
1061398297 9:130355195-130355217 TGAGGCCTGGGCTGTGGGGCCGG + Intronic
1062197956 9:135285022-135285044 AGGTGCCTGGGCTGGAGCTCGGG + Intergenic
1062276698 9:135734792-135734814 GGGTGCCTGGGCTGCGGATGCGG - Intronic
1062277145 9:135736494-135736516 GGGTGCCGGGGCTGGGGGGCTGG - Intronic
1062433222 9:136535154-136535176 TGGTGTCTGGGCTGCAGCTGAGG + Intronic
1062498989 9:136844307-136844329 CGGGGCCTGGGCTGCGGAGGGGG + Intronic
1062544472 9:137055323-137055345 TGCTGCCTGGGCTGAGGGTCTGG + Intergenic
1062613098 9:137383754-137383776 TGGTGCCAGGACTGCGGTGCAGG - Intronic
1062716966 9:138015587-138015609 TGCTGCGTGGCCTGCGGAGCGGG + Intronic
1185459369 X:327825-327847 TCATCCCTGGGCTGCAGCGCTGG - Intergenic
1189309580 X:40010089-40010111 TGATGCCTCAGCTTCGGCGCTGG - Intergenic
1190062300 X:47219171-47219193 AGGGGTCTGGGCTGCGGGGCTGG + Intronic
1190736089 X:53256655-53256677 TGGTGCCTGGACTCCGGGCCAGG + Intronic
1191136525 X:57070336-57070358 TGGGCCCTGGGCTGCGGAACCGG - Intergenic
1191873909 X:65774870-65774892 TGTTGCCTAGGCTGCAGTGCAGG + Intergenic
1191878653 X:65822423-65822445 TGGCGGCTGGGGTGTGGCGCAGG - Intergenic
1195306214 X:103586086-103586108 TGGCGGCTGGGGTGCGGCGGAGG + Exonic