ID: 1126163509

View in Genome Browser
Species Human (GRCh38)
Location 15:45634915-45634937
Sequence GCCTGGGCTGCGGCGCCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 491}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163500_1126163509 2 Left 1126163500 15:45634890-45634912 CCCTGGTGTGTTCACTGACCATG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG 0: 1
1: 0
2: 2
3: 54
4: 491
1126163501_1126163509 1 Left 1126163501 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG 0: 1
1: 0
2: 2
3: 54
4: 491
1126163497_1126163509 19 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG 0: 1
1: 0
2: 2
3: 54
4: 491
1126163499_1126163509 18 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG 0: 1
1: 0
2: 2
3: 54
4: 491
1126163496_1126163509 20 Left 1126163496 15:45634872-45634894 CCCCGTGAGCGCTCAACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG 0: 1
1: 0
2: 2
3: 54
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163509 Original CRISPR GCCTGGGCTGCGGCGCCGGG CGG Exonic
900119094 1:1041016-1041038 GCCTGGGGGGCGGAGCGGGGCGG + Intronic
900119132 1:1041091-1041113 GCCTGGGGGGCGGAGCGGGGCGG + Intronic
900413913 1:2526419-2526441 GCGCGGGCTGCGGGGGCGGGCGG - Intronic
900438793 1:2643345-2643367 GGCTGGGCTGCGGCGCCAGGAGG - Intronic
900637914 1:3674894-3674916 GCCTGGGCAGAGGGGTCGGGCGG - Intronic
900932674 1:5746963-5746985 GTCTGGGCTGCCGCTCAGGGAGG - Intergenic
901646214 1:10718120-10718142 GCCTGGGCTGGGGCCCCAGCTGG - Intronic
901930811 1:12595435-12595457 GGCGGGGCTGCAGTGCCGGGTGG + Intronic
902334742 1:15748406-15748428 GCCTGGGCTGGGTCCCCTGGGGG + Intergenic
902585638 1:17437703-17437725 GCCTCGGCTCCGGCGCCCGGGGG - Intronic
902859450 1:19234564-19234586 GCGTGAGCTGCTGCGCCTGGGGG - Intronic
903223402 1:21881309-21881331 GCCTGGGCTGCCACCCTGGGTGG - Intronic
904003214 1:27350108-27350130 GTCCGAGCGGCGGCGCCGGGCGG - Exonic
904025272 1:27498929-27498951 GCCTGGGAGGCTGGGCCGGGTGG - Intergenic
904747448 1:32719891-32719913 GCCAGGCCTGAGGGGCCGGGTGG + Intergenic
905031225 1:34885646-34885668 GGCGGAGCTGCAGCGCCGGGCGG + Exonic
905846920 1:41241671-41241693 GTCTGGCCGGCGGGGCCGGGTGG - Intronic
906161248 1:43650510-43650532 GCCAAGGCGGCGGGGCCGGGAGG + Intronic
906365397 1:45205905-45205927 GCCGGAGCGGCGGCCCCGGGGGG + Exonic
906535840 1:46550519-46550541 GCCTGGGCGGGGGCGGGGGGTGG + Intronic
907308570 1:53526906-53526928 ATGTGGGCTGCAGCGCCGGGCGG + Intronic
908534756 1:65067149-65067171 GCGGGGGCGGCGGCGCGGGGCGG - Intergenic
912834780 1:112986492-112986514 GCTTGGGCTGCTGCTCCAGGAGG - Intergenic
913660885 1:121005556-121005578 GCCTGAGCCACGGCGCCCGGCGG - Intergenic
914165584 1:145172419-145172441 GCCTGAGCCACGGCGCCCGGCGG + Intergenic
914242089 1:145859011-145859033 GCCTGAGCTCCGGCTCCGGCTGG - Exonic
915331006 1:155112332-155112354 GCCTGGGCTGCTGTCCCAGGAGG + Intergenic
916656274 1:166878205-166878227 GCCTGGGCTTCTGGGCTGGGTGG + Intergenic
917905836 1:179586624-179586646 GCCTGGCCTCCCGCGGCGGGTGG - Intergenic
919678444 1:200409807-200409829 GTCTGGGCGGCGGCGCGGCGGGG - Intronic
919727039 1:200891282-200891304 GCCTGGGCTGCGGAAACTGGCGG + Intronic
919820422 1:201468837-201468859 TCCTGCGCTGCGGGGCCGAGAGG - Exonic
920029174 1:203026437-203026459 GCCTAGGGGGCGGAGCCGGGGGG + Intergenic
920351837 1:205343058-205343080 GGCTGGGGTGTGGCGGCGGGAGG + Intronic
920511854 1:206557503-206557525 GCTTGGGATGCGGCGGAGGGAGG - Intronic
920528580 1:206685586-206685608 GCCTGGGTCGCGGCGCGGGGCGG + Intronic
921051554 1:211515267-211515289 GCCTGGGCTGAGGCGGCTGGGGG - Intergenic
921930278 1:220748841-220748863 GCCTGGGATGAGGAGCGGGGGGG + Intronic
922764670 1:228150703-228150725 CCCAGGGCTGCTGCGCAGGGAGG + Intronic
923008005 1:230067381-230067403 GCGCGGGCGGCGGCGCCGGCAGG + Exonic
923157836 1:231293986-231294008 GTCTGGGTGGTGGCGCCGGGGGG + Intergenic
923506305 1:234609259-234609281 GCCGAGGCCGCGGCGCCGGGTGG + Exonic
1062760234 10:11989-12011 GCCGAGCCTGCAGCGCCGGGTGG - Intergenic
1062863718 10:831490-831512 GCCTGGGCCGCAGAGCCGGCAGG + Intronic
1063623381 10:7667668-7667690 GGCCGGGAAGCGGCGCCGGGCGG - Intergenic
1065099871 10:22321795-22321817 GCCCCGGCCGCGCCGCCGGGAGG + Intronic
1069581796 10:69571797-69571819 GCCTGGTCTTCCGCCCCGGGAGG + Exonic
1069823198 10:71239996-71240018 GGCTGGGCTGGGGCTCCAGGCGG + Intronic
1069857933 10:71451914-71451936 GCCTGGCCTGAGGCTCCAGGAGG - Intronic
1070147006 10:73781921-73781943 GCCGGGGCTGCGGCGACGCTGGG - Intergenic
1070245846 10:74730625-74730647 GCCTGGGCTGCAGCTCCAGAGGG + Intergenic
1070854414 10:79595054-79595076 GCCTGGGGTGCAGTGCTGGGAGG + Intergenic
1073479791 10:103779315-103779337 GCCTGGCATGAGGCGCCGTGCGG + Intronic
1074377386 10:112951300-112951322 GCCCGGGGGGCGGCTCCGGGCGG - Intronic
1074830052 10:117241542-117241564 GCCGAGGCTGGGGCGCCCGGGGG + Intronic
1075501729 10:122980715-122980737 GCCTGGGCCGCGGGGCGGGGCGG + Intronic
1076374056 10:129971896-129971918 GCGAGGGCGGCGGCGGCGGGAGG - Intergenic
1076402966 10:130195330-130195352 GCCTGGGCCGCTGCGGCAGGAGG + Intergenic
1076577286 10:131477763-131477785 GCGTGTGCTGCAGTGCCGGGTGG + Intergenic
1076781855 10:132728908-132728930 GCCTGGGCTCCGGTGCCTGTGGG + Intronic
1076793580 10:132788525-132788547 GCCTGGGCTCCGCCGCCCGGCGG + Intergenic
1076849975 10:133087982-133088004 TGCGGGGCTGCGGCGCCGGCCGG - Exonic
1076911290 10:133391422-133391444 GCCTGGGCTGCTGCACCTGCGGG - Exonic
1077008447 11:369719-369741 GCCGGGGATGCGGCGCGGGGCGG + Intergenic
1077052800 11:575432-575454 GCCTGGGCTGGGGCCCGGGTGGG - Intergenic
1077476538 11:2792954-2792976 GCCTGACCTGCGGCTCCCGGGGG - Intronic
1078091676 11:8268200-8268222 GCCCGGGCTTCGGCGGCGGCGGG - Intronic
1078246220 11:9574539-9574561 GCCGGGGCCGCGGCGCCGGAGGG + Intronic
1078801121 11:14644512-14644534 GCCGGAGCTGCGGCTCCTGGTGG + Exonic
1079122524 11:17695924-17695946 GCCGGGGCTGCGGTGAGGGGAGG + Intergenic
1082770266 11:57202426-57202448 TCCTTGGCTGTGGCGCCGGCAGG + Intergenic
1082986155 11:59172567-59172589 CCCGGGGCTGCGGCGCTGCGCGG - Exonic
1083184145 11:61007821-61007843 TCCTGTGCAGCGGCGCCGAGTGG + Exonic
1083328241 11:61884616-61884638 GCCTGGGCTGGGGGGCAGGAAGG + Intronic
1083885739 11:65572682-65572704 CCCTCGGCAGAGGCGCCGGGCGG + Exonic
1083886518 11:65576005-65576027 GGCGGGGCTCCGGCGCGGGGCGG - Intergenic
1083940020 11:65890735-65890757 TCCTGGGCCGCGGCGGCGGGCGG + Exonic
1084267949 11:68014602-68014624 GCCGGGGCTGTGGTGCTGGGAGG - Intronic
1084572072 11:69965954-69965976 GCCTGGGGTAGGGCCCCGGGAGG - Intergenic
1085050332 11:73376900-73376922 GGCGCGGCTGCGGCGCGGGGCGG + Intronic
1085197941 11:74683556-74683578 GCCTGGGCCGCGGGGGCGGCGGG - Intergenic
1085266730 11:75241831-75241853 GCCTGCGCTGCGCCGCCCCGCGG + Exonic
1085312755 11:75525913-75525935 GCTCGGGCTGCGGCTCCGGTGGG - Intergenic
1085507131 11:77066997-77067019 CCCGAGGCTGCTGCGCCGGGCGG + Exonic
1085741124 11:79079321-79079343 TCCTGAGCTGCGGAGCTGGGAGG + Intronic
1089257811 11:117203204-117203226 CCCTGGGCTAGGGCGCTGGGGGG + Intronic
1089366832 11:117925827-117925849 CCCTGGGCTGGGGAGCTGGGTGG - Intronic
1090385506 11:126355757-126355779 GCCAGCGCTGCGCCGCCGGTCGG + Intronic
1091286643 11:134411988-134412010 GCCGGGGCGGCGGGGCCGGGCGG - Intergenic
1202808456 11_KI270721v1_random:17284-17306 GCCTGGGCTGGGGCTCGGGTTGG + Intergenic
1091748779 12:3010005-3010027 CCCTGTGCTGCGGAACCGGGAGG - Intronic
1092219145 12:6700865-6700887 GCGTGGCCTCCGGCGCGGGGGGG - Intergenic
1092242019 12:6841063-6841085 TCCTGGGCTGGGGCGCAGGCAGG + Intronic
1092250258 12:6891147-6891169 ACCTGGGCGGCTGCGCGGGGCGG - Intronic
1094421545 12:30276807-30276829 TTCTAGGCTGCGGTGCCGGGAGG - Intergenic
1094427742 12:30332935-30332957 TCCTAGGCTGCGGTGCAGGGAGG + Intergenic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1095949304 12:47773285-47773307 CATGGGGCTGCGGCGCCGGGCGG - Exonic
1096077534 12:48814751-48814773 GCCTGGGCAGCGCCGCCTGCTGG + Intronic
1096099076 12:48957779-48957801 GGCTGGGCTGCGGGGCCCAGGGG + Intergenic
1096139937 12:49234551-49234573 GCCAGGACTGCGGCGCCACGCGG - Intronic
1096145463 12:49275865-49275887 GCCTGGGCAGGGGAGCGGGGTGG + Intergenic
1096674923 12:53221212-53221234 GCCCGGGCCGCGGCGGAGGGCGG - Intronic
1096784469 12:54009186-54009208 GCCTGGGGTTCGGTCCCGGGGGG + Exonic
1101680055 12:106955969-106955991 GCCTGGGCGGCAGCGGCGGCCGG - Exonic
1102519043 12:113467764-113467786 GCCCGCGCTTCGGCGCAGGGAGG + Intronic
1102520078 12:113472475-113472497 GCCTGGGCTCGGCGGCCGGGCGG - Intergenic
1102571657 12:113830560-113830582 GCTAGGGCTGCGGGGCGGGGGGG + Intronic
1102884099 12:116508672-116508694 GCCTGAGCAGCGGCCCTGGGAGG - Intergenic
1103261636 12:119593824-119593846 GCGAGGCCGGCGGCGCCGGGAGG - Exonic
1104840028 12:131819392-131819414 GCCTGGGCTGAGGCCCCCTGGGG - Intergenic
1105012014 12:132762101-132762123 GCCGGGGCTGGGGCCCGGGGAGG + Intergenic
1105631040 13:22168657-22168679 ACCTGGGCTGCTGCGCAGAGGGG + Intergenic
1106231049 13:27821257-27821279 GCCTGGGCTGGGGCGCAGTGGGG - Intergenic
1106517158 13:30465382-30465404 GGCTCGGCGGCGGCGGCGGGAGG - Intronic
1106735835 13:32586913-32586935 GCCGGGGCGGCGGCGGCGGCGGG + Intronic
1108541644 13:51452217-51452239 GCCCGGGCTCCGGCCCCGGGCGG - Intronic
1110450797 13:75636127-75636149 GCCCGGGCCGCGGCCCCTGGCGG + Intronic
1111951661 13:94713049-94713071 GCCAGGCCTGCGGCGCCGCGTGG - Intergenic
1113379210 13:109787005-109787027 GCCGGGGAGGGGGCGCCGGGCGG + Intergenic
1113568983 13:111339745-111339767 CCATGGGCAGCCGCGCCGGGAGG + Intronic
1113716089 13:112508854-112508876 GCTTGGGCTGTGGCGCCAGCAGG - Intronic
1113885181 13:113655113-113655135 GCCGGTGGTGCGGCGCTGGGAGG - Intronic
1114659431 14:24335101-24335123 GAGGGGGCCGCGGCGCCGGGAGG - Intronic
1116014198 14:39386896-39386918 GCCGGGGCTCCTGCCCCGGGCGG - Intronic
1116658197 14:47675889-47675911 GCCTGGGGTTCGACGCCGGCCGG + Intergenic
1116817922 14:49599939-49599961 GCCGGGGCGGGGGCTCCGGGGGG + Intronic
1117722092 14:58638117-58638139 GCTAGGGCTGCGGCCGCGGGTGG - Intronic
1117875929 14:60249723-60249745 GCCTGCGCGGCGGCGGCGGCGGG + Intronic
1118137450 14:63045402-63045424 GTCTGGGCAGCGGCGGCCGGGGG - Exonic
1118392048 14:65303926-65303948 GGCTGGGCTGGGGGGCTGGGGGG - Intergenic
1119003988 14:70907826-70907848 GCGACGGCGGCGGCGCCGGGTGG + Exonic
1119304012 14:73592352-73592374 GCCAGGGGTGCGGCGCCAGTCGG + Exonic
1121595247 14:95157311-95157333 GCGGGGGCGGCGGCGCCGGGCGG - Intronic
1122275137 14:100587248-100587270 GCCGGGCCGGCTGCGCCGGGCGG - Intronic
1122582193 14:102777751-102777773 CCCTGGGCGGCGGGGCCCGGGGG + Intronic
1122621061 14:103057758-103057780 GCCTGGGGAGCGGCGCGGGGTGG + Intergenic
1122923160 14:104888248-104888270 GCCTGGGCTTCGGGGCCCTGAGG - Intronic
1123002226 14:105301516-105301538 GCCAGGGCAGCTGCGCTGGGGGG + Exonic
1123039240 14:105483656-105483678 GGCTGGCCTGCAGCCCCGGGAGG + Intergenic
1123056322 14:105572285-105572307 GCCTGAGCTGCCGGGTCGGGGGG + Intergenic
1123057609 14:105579522-105579544 GCCTGAGCTGCCGGGTCGGGGGG - Intergenic
1123080753 14:105692413-105692435 GCCTGAGCTGCCGGGTCGGGGGG + Intergenic
1123081888 14:105699455-105699477 GCCTGAGCTGCCGGGTCGGGGGG - Intergenic
1123558053 15:21452482-21452504 GCCCAGGCTGCGGCGCCGCAGGG + Intergenic
1123594281 15:21889763-21889785 GCCCAGGCTGCGGCGCCGCAGGG + Intergenic
1123719730 15:23049830-23049852 ACCTGGGCAGAGGTGCCGGGGGG + Intergenic
1123719854 15:23050261-23050283 GCCTGGCCAGAGGTGCCGGGGGG + Intergenic
1123783186 15:23646242-23646264 GGATGGGCGGCGGCGCCTGGCGG + Exonic
1124533562 15:30525554-30525576 GCCTGGGAAGCGGCGCCGAATGG - Intergenic
1124765093 15:32482091-32482113 GCCTGGGAAGCGGCGCCGAATGG + Intergenic
1125383850 15:39115435-39115457 GCATGGGCTGGGGAGGCGGGGGG + Intergenic
1125589139 15:40843918-40843940 ACCGGGGCTGCGGGGCCGCGGGG + Intergenic
1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG + Exonic
1126592449 15:50354422-50354444 CCCTGTGCTGCGGGGCCGAGAGG - Intronic
1127877206 15:63121899-63121921 GCCCGGGCTGCCGCCCCCGGGGG + Exonic
1128153551 15:65377872-65377894 GCCGGGGCTGGGGCTCCGGCCGG + Exonic
1128455264 15:67828197-67828219 GGCAGGGCTGCGGGGCCGGGCGG + Intronic
1128550617 15:68595952-68595974 GCCAGGGCAGCGACGCCGTGGGG + Intronic
1128999353 15:72319855-72319877 GACATGGCCGCGGCGCCGGGAGG - Exonic
1129468784 15:75738767-75738789 GCGCGGGCTGCGGGGCGGGGTGG - Intergenic
1130540395 15:84817475-84817497 GCCGGGGCTGGGGCGCGGGTGGG + Exonic
1130550717 15:84888647-84888669 GACTGGGCTGGGGCACAGGGAGG - Intronic
1131053474 15:89362593-89362615 GCCGGGGCAGGGGCGCCCGGAGG + Intergenic
1131115165 15:89790895-89790917 GCCGAGGCTGGGGCCCCGGGGGG - Intronic
1131438176 15:92439488-92439510 GCCAGGGCTGGGGAGCCGGCTGG - Intronic
1202966403 15_KI270727v1_random:179654-179676 GCCCAGGCTGCGGCGCCGCAGGG + Intergenic
1132502719 16:291730-291752 GCCTCAGTTGTGGCGCCGGGGGG - Intronic
1132555090 16:568818-568840 GCCTGGGCAGGGGCACCTGGTGG - Exonic
1132585837 16:705474-705496 GGCCGGGCTGCGGGGCCGGGAGG - Intronic
1132669393 16:1096467-1096489 GCCTGGGGTGCGGCGCCCTGAGG + Intergenic
1132731977 16:1367169-1367191 GCCGGGGCTGCGGGGCTGTGGGG - Intronic
1132815834 16:1826254-1826276 ACGGGGGCTCCGGCGCCGGGCGG + Intronic
1132877929 16:2148559-2148581 GCATTGGCGGCGGCGGCGGGAGG + Intronic
1132934939 16:2475349-2475371 GCCGCAGCTGCAGCGCCGGGCGG - Intronic
1132947261 16:2538327-2538349 GCCTGGGTTGCGGCGGGCGGCGG + Intronic
1133188518 16:4116574-4116596 GCTGGGGCTGCGGGGCGGGGCGG + Intergenic
1133211133 16:4264007-4264029 GCCGGGGCTGCGGCTTCGGGTGG - Intronic
1133220190 16:4316325-4316347 GCCGGGGCTGCGGGGCCCGAGGG + Intronic
1133284873 16:4686013-4686035 CCCTAGGCTGCGGCAGCGGGAGG + Intronic
1133784562 16:8964027-8964049 GCCTCGGCGGCGGCGGCAGGCGG - Intronic
1134441819 16:14303012-14303034 GCATGGGCGGCGGCGCCTGCGGG + Intergenic
1135135469 16:19883657-19883679 GCGTGGGCTGGGGCCCCAGGCGG + Intronic
1135273256 16:21086805-21086827 GCCTGGGCTGCGCTGCTTGGGGG + Intronic
1135517755 16:23149485-23149507 GCCGGGCGGGCGGCGCCGGGAGG - Intergenic
1135521591 16:23182553-23182575 GGCCGGGCTGGGGCGCAGGGCGG + Intergenic
1136267873 16:29131536-29131558 GCCTGGCCTGGGGCGCCCTGAGG - Intergenic
1137449228 16:48555285-48555307 GCCTGGGTTGCAGAGCCAGGGGG + Intronic
1139471522 16:67180430-67180452 GCTGGGGCTGCAGCGCTGGGGGG + Exonic
1139785001 16:69385728-69385750 GCCGGGGCTGGGGGGCCCGGCGG - Exonic
1139954120 16:70685323-70685345 GTCTGGGCTCCGGGGCCGTGGGG + Intronic
1140096901 16:71883667-71883689 GCGCGGGGTGCGGGGCCGGGGGG - Intronic
1141231266 16:82170043-82170065 GCCGGGGCCGAGGCGGCGGGCGG - Intronic
1141423309 16:83930909-83930931 GCCTGGGAGGAGGCACCGGGTGG + Intronic
1141531283 16:84648594-84648616 GCCCCGGCGGCGGGGCCGGGCGG - Exonic
1141581523 16:85002856-85002878 AGCGGGGCTGCGGCGCTGGGAGG + Intronic
1141665336 16:85462799-85462821 GCCGGGGGCGCGGGGCCGGGGGG + Intergenic
1141840122 16:86568559-86568581 CCCCGGGCTGCGGCGTCGGCTGG - Exonic
1142071176 16:88091883-88091905 GCCTGGCCTGGGGCGCCCTGAGG - Intronic
1142163323 16:88570596-88570618 GCCGGGCCGGCGGCGGCGGGAGG + Intronic
1142252294 16:88997552-88997574 GCCAGGGCTGCGGGGGCTGGTGG + Intergenic
1142263001 16:89051266-89051288 GGCTGGGCTGAGGGGCAGGGAGG - Intergenic
1143135606 17:4710772-4710794 GCATGGGCGGCGGCTCGGGGCGG + Intronic
1143201345 17:5115826-5115848 GCCCGGGCTGTGTCCCCGGGAGG - Intronic
1143526860 17:7478167-7478189 GTCTGGGCTGCTGAGCTGGGAGG - Intronic
1143635580 17:8162408-8162430 GCCCTGGCTGCGGGGCCGGGAGG - Intronic
1143742663 17:8965713-8965735 GCCTGGGCTCCTCCGGCGGGCGG + Intergenic
1143747304 17:9003687-9003709 GCCGGGGCCGGGGCACCGGGAGG - Intergenic
1143904531 17:10198443-10198465 GGCTGGGCAGCGGCTCCGCGGGG + Exonic
1146174040 17:30653468-30653490 GCCAGGGCTGCAGCTCCAGGAGG + Intergenic
1146256094 17:31392130-31392152 TCCTGGGCTCCGGCGGAGGGAGG - Intronic
1146347495 17:32069495-32069517 GCCAGGGCTGCAGCTCCAGGAGG + Intergenic
1146654280 17:34626158-34626180 GGCTGGCCTGCGGCCCCGGCGGG - Exonic
1146660746 17:34663716-34663738 GCCTGGGCTGCAGCAGGGGGAGG - Intergenic
1147134894 17:38428844-38428866 GGCTGGGCAGCGGGGGCGGGAGG + Intronic
1147360506 17:39927091-39927113 ACCTCGGGTGCGGGGCCGGGGGG + Intronic
1147388602 17:40095948-40095970 GCCTGGGGTGGGGTGCTGGGTGG + Exonic
1147393281 17:40122688-40122710 GAGCGGGCTGCGGCGCTGGGCGG + Exonic
1147970974 17:44219079-44219101 GCCGGGGCGGGGGCGCCGGCGGG - Intronic
1148629065 17:49092605-49092627 GCCTGGGCTGGGGCGGGGGTGGG + Intergenic
1149986827 17:61353758-61353780 GCCTGGGCTGCTGAGTCAGGCGG + Intronic
1151481466 17:74372246-74372268 GAGTGGGCTGCAGCCCCGGGTGG + Exonic
1151674093 17:75589099-75589121 GCCTGGGAAGCGGCGCCTGGCGG - Intergenic
1151866424 17:76806248-76806270 GGCGGGGCGGCGGGGCCGGGGGG - Intergenic
1152697472 17:81804256-81804278 ACCTGGGCCGCGGCCCCGAGGGG + Intronic
1152755097 17:82083921-82083943 GCCAGGGCGGCGGGGCCAGGAGG + Intronic
1152953142 18:12343-12365 GCCGAGCCTGCAGCGCCGGGTGG - Intergenic
1153805270 18:8705195-8705217 GCCTGGGCGAGGGCGCTGGGCGG + Intergenic
1155474802 18:26226955-26226977 GCCGGGGGAGCGGCGCCGGCGGG - Exonic
1155518850 18:26649396-26649418 TCCTGGGCTGTGGGGCAGGGAGG - Intronic
1156350443 18:36297673-36297695 GCCCGGGCTCCGGCCGCGGGGGG - Intergenic
1157298213 18:46461127-46461149 CCCTGGACTGGGGAGCCGGGAGG + Exonic
1157842137 18:50968283-50968305 GGGTGGGCGGCGGCGCCGGGCGG - Intronic
1159770853 18:72543853-72543875 GGCGGGGCTGCGGGGCCGAGGGG - Intronic
1160156869 18:76441339-76441361 GCCAGGGCTGCTGGGCTGGGAGG + Exonic
1160345230 18:78127179-78127201 GCTTGGGCAGCGGCGAGGGGTGG + Intergenic
1160510680 18:79451845-79451867 GCCTGGGCTTCGGCGCTGGTGGG + Intronic
1160668438 19:344515-344537 GCATGCGCGGCGGCGCGGGGCGG - Intronic
1160729067 19:632520-632542 GCCTTGGCGGCGGGGCCGGGGGG + Intronic
1160736086 19:663019-663041 GCCCGGGCCGGGGCGGCGGGCGG - Intronic
1160763553 19:797537-797559 GGCAGGGCTGCGGCGCGGGGAGG - Intronic
1160851559 19:1195306-1195328 GCCTGGGCATCGGAGCCGGGGGG + Intronic
1160851983 19:1197120-1197142 GCCTGGGCATCGGAGCCGGGGGG + Intronic
1160858977 19:1229707-1229729 GCGCGGGCTGCGGGGCCGGGCGG + Exonic
1160909249 19:1467295-1467317 TCCTGGTCCGCGGCGCCGCGAGG - Exonic
1160930463 19:1567638-1567660 GCCGGGGCGGCGGCGGCGGCGGG + Exonic
1161059455 19:2207799-2207821 GCCTGAGCTCAGGGGCCGGGGGG - Intronic
1161062979 19:2224274-2224296 GCCTGGGCGGAGGTGCTGGGTGG + Intronic
1161108708 19:2456641-2456663 GCCGGGGCTTAGGGGCCGGGCGG - Intronic
1161252116 19:3285864-3285886 GCCTGGGCCGCTGGGCGGGGAGG - Intronic
1161562058 19:4978903-4978925 GCCTGGTCAGGGGCGCAGGGTGG + Intronic
1161963207 19:7534170-7534192 GCCGTGCCTGCGGAGCCGGGCGG + Exonic
1162741376 19:12775590-12775612 GCCTGGGCTTGGGGGCGGGGCGG - Intronic
1162954809 19:14091801-14091823 GCCTGGGGTGGGGCCCCGGGTGG - Exonic
1162988371 19:14286562-14286584 GCCAGGGCTGCAGCTCCAGGAGG - Intergenic
1163290611 19:16376971-16376993 ACCTGGGCAGCTGGGCCGGGGGG + Intronic
1165089264 19:33374044-33374066 GCGCGGGCGGCGGCGCCGCGCGG + Intronic
1165129238 19:33621890-33621912 GCCGGGGGCGGGGCGCCGGGCGG + Intergenic
1165384337 19:35501746-35501768 GCCTAGGCTGCGGCATGGGGAGG - Intronic
1166113026 19:40634667-40634689 GCTTGGGCTGCGCCGGCGCGCGG - Intergenic
1166317984 19:41999210-41999232 GCCCGGGCGTCGGCGCCGGCGGG + Exonic
1166694771 19:44846337-44846359 GCCGGGGGTGCCGAGCCGGGCGG + Intronic
1167056081 19:47112384-47112406 GCCGGGGCTGCGTCCCCGGGGGG - Intronic
1167278390 19:48552415-48552437 GCCAGGCCTGCGGCTGCGGGTGG - Intronic
1167578328 19:50328315-50328337 ACGCGGGCGGCGGCGCCGGGGGG - Exonic
1167602344 19:50461708-50461730 GCCTGGGCTGTGGGGCAGGATGG - Intronic
1167674806 19:50877542-50877564 GCCTGGGAGGAGGGGCCGGGAGG + Intronic
1168257210 19:55173570-55173592 GGCTGGCCTGCGGCACTGGGCGG - Exonic
1168351028 19:55675490-55675512 GCCTGGGCCGCGGCGCGCGCGGG + Intronic
1168607264 19:57769954-57769976 GCCTGGGCTGCAGGGACGCGAGG - Intronic
1202681422 1_KI270712v1_random:7111-7133 GCCGGGGCGGCGGCGGCGGAGGG + Intergenic
924962475 2:46623-46645 GCCAGGGCCGGGGCACCGGGCGG - Intronic
924987691 2:287353-287375 GCGTGAGCTGCGGCGCGGGTCGG - Intronic
926217425 2:10914041-10914063 GCCTTGGCAGAGGTGCCGGGAGG - Exonic
926880687 2:17540576-17540598 GCTGGGGCTGCGGAGCTGGGGGG + Intronic
927472389 2:23385805-23385827 GCCTCGGATGCGGCGCCGGAGGG + Intronic
927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG + Intronic
929308945 2:40399904-40399926 GCCCAGGGTGTGGCGCCGGGCGG - Intronic
929966915 2:46542995-46543017 GCCGGGGCGGGGGCTCCGGGGGG + Exonic
930020712 2:47000523-47000545 GCCTGGCCTGGGTCGCTGGGTGG + Intronic
931253379 2:60551803-60551825 GGCTGGGCTGGGGCGCGGCGAGG + Intronic
931395896 2:61888344-61888366 GCCTGACCCGCGGCGCCGCGGGG - Intronic
931515290 2:63047679-63047701 GCGTGGACTCCGGCGCCTGGCGG + Intergenic
931587284 2:63841733-63841755 GCCTGGACGGCGGCGCGGGGAGG + Exonic
932068088 2:68588209-68588231 GCCTGGGCCGTGGCCCCTGGAGG - Intronic
933772467 2:85753366-85753388 GACTGGGTTGCCGTGCCGGGCGG + Intronic
936400800 2:112163132-112163154 GCCTGAGCTGGGGCGGAGGGAGG - Intronic
936410547 2:112254646-112254668 GCCTGGGCGGGGGAGCGGGGTGG - Intronic
937208587 2:120252893-120252915 GGCTGGGGTCCGGCCCCGGGAGG + Exonic
937329917 2:121019992-121020014 GCCTGGGCTGATGAGCTGGGAGG - Intergenic
938082225 2:128376350-128376372 CCCTGGGCTGGGGTGCTGGGAGG + Intergenic
938368771 2:130756072-130756094 GCCCGAGCGGCGGCGCAGGGAGG + Intronic
938455672 2:131460947-131460969 GCCGGGGCGGGGGCTCCGGGGGG + Intergenic
938496626 2:131801400-131801422 GCCGAGGCTGCAGCGCCGGGTGG + Exonic
941816254 2:169798890-169798912 GGCTGGCCGGCGGCGCTGGGAGG + Intronic
942453271 2:176121787-176121809 GGCAGGGCTGAGGCGGCGGGCGG + Intergenic
942890492 2:180981010-180981032 GCCGGGGCGGCGGCGGCGGTGGG + Intronic
944242451 2:197499653-197499675 GCCTGCGGTGCGGCGCGGTGCGG + Intronic
944413546 2:199463369-199463391 GCCGGGGTTGGGGCCCCGGGTGG + Intronic
946226238 2:218265521-218265543 GCCTGGGCTGGGGGCCCGGGAGG - Intronic
946327792 2:218993622-218993644 GCCTGGGCTGCGGCGGGCGCGGG - Intergenic
946391429 2:219418939-219418961 GCGGGAGCTGCGGCGCCAGGTGG + Exonic
947549835 2:231038036-231038058 GCCGGGGCTGCGGCTGCTGGAGG + Exonic
947765281 2:232633786-232633808 TCCGGGGCTGGGGCGCCGAGGGG - Exonic
947860568 2:233354709-233354731 GCCGGGGCTGCCGCGGCGTGAGG - Intronic
947938033 2:234024544-234024566 GCCTGGGCCGCAGGGCCGGCTGG + Intergenic
948037855 2:234873648-234873670 GCCTGGCCTGCTGCGCTGTGTGG + Intergenic
948216540 2:236237341-236237363 GCCGGGGCCGGGGCGCGGGGCGG + Intronic
948216555 2:236237366-236237388 GCCGGGGCCGGGGCGCGGGGCGG + Intronic
948216570 2:236237391-236237413 GCCGGGGCCGGGGCGCGGGGCGG + Intronic
948429829 2:237912280-237912302 GTCTGGACTGTGTCGCCGGGGGG - Intergenic
948477744 2:238231399-238231421 GCGCGGGCTGCGGGGCCCGGCGG - Exonic
949045619 2:241871535-241871557 GCCTTGGCCGCGGCCCTGGGTGG + Intronic
1168757035 20:325309-325331 GCTCGGGCTGCGGGGCTGGGCGG - Intergenic
1170630024 20:18057768-18057790 GCCTGGGCCGCGCCGCGGCGGGG - Exonic
1170889801 20:20367863-20367885 GGCGGGGCGGCGGCGCCGGGCGG + Intergenic
1171346610 20:24470224-24470246 GCCAGGGCTGGTGAGCCGGGCGG + Intronic
1171348700 20:24486286-24486308 GCCTGGGCTGGGGAGCCAGGTGG + Intronic
1171427526 20:25058067-25058089 CCCTGGGCCGCGGCGTCGGGAGG - Exonic
1172118373 20:32584341-32584363 GCCCGGGCAGCGGCGCGGAGGGG + Intronic
1172520566 20:35562895-35562917 GCTTGTGCTGCGGCGCTGGCAGG - Intergenic
1173166080 20:40688243-40688265 GCCTCGGCGACGGCGGCGGGCGG - Exonic
1173488392 20:43458215-43458237 GCCAAGGCCGCGGCGCCGCGTGG + Intronic
1174405289 20:50298933-50298955 GCCTGGGCTCCGGCAGCGGGTGG + Intergenic
1175252245 20:57616678-57616700 GCCTTGGCTGCGCAGCCTGGTGG + Intronic
1175429526 20:58891679-58891701 GGCCGGGCTGCGGCGGCGGCGGG - Intronic
1175517205 20:59577340-59577362 GGCGAGGCTGCGGCTCCGGGCGG + Intergenic
1175521519 20:59605139-59605161 GGCTGGGCGGGGGCGGCGGGCGG + Intronic
1175859783 20:62143899-62143921 GCCGGAGCGGCGGCGCTGGGCGG + Intronic
1175962158 20:62642640-62642662 GCAGGGGCTGGAGCGCCGGGGGG + Intronic
1175997107 20:62816892-62816914 GGCTGGGCGGCGGCGCGGGGCGG + Intronic
1176016907 20:62938426-62938448 CCCTGGGCACCGGCGCGGGGCGG - Intronic
1176139818 20:63540002-63540024 TCCTGGGCTGGGGGTCCGGGCGG + Intergenic
1176179501 20:63742716-63742738 CCGTGGGCTGCGGCTCCAGGCGG - Exonic
1176194325 20:63830607-63830629 GGCTGGGCTGTGCCGGCGGGGGG + Intronic
1176549489 21:8214993-8215015 GCCGGGGCGGGGGCGCGGGGAGG - Intergenic
1176557384 21:8259222-8259244 GCCGGGGCGGGGGCGCGGGGAGG - Intergenic
1176568414 21:8398027-8398049 GCCGGGGCGGGGGCGCGGGGAGG - Intergenic
1176576326 21:8442257-8442279 GCCGGGGCGGGGGCGCGGGGAGG - Intergenic
1180095032 21:45552469-45552491 GCCTGGCCTGAGCCTCCGGGTGG - Intergenic
1180791452 22:18577599-18577621 GCCTGGGCTGGGGCGCACGCGGG - Intergenic
1181164675 22:20976911-20976933 GTCTGAGCTGCGGGGCCAGGAGG + Exonic
1181230287 22:21417712-21417734 GCCTGGGCTGGGGCGCACGCGGG + Intronic
1181248363 22:21517151-21517173 GCCTGGGCTGGGGCGCACGCGGG - Intergenic
1181280592 22:21717129-21717151 GCCGGGGCTGGGGGGGCGGGGGG + Intronic
1181299144 22:21867263-21867285 GCGTCCGCTGCGGCCCCGGGCGG + Intronic
1181299339 22:21868031-21868053 GCCTGAGCTGCGGCGCTGCCGGG - Intergenic
1181632026 22:24156381-24156403 GCTTGGGCGGCGGCGCGCGGGGG + Intronic
1181643096 22:24215095-24215117 GCCTGGGCCGGGGTGCTGGGAGG - Intergenic
1181670620 22:24424058-24424080 GTCGGGGGTGCGGGGCCGGGAGG + Intronic
1181731129 22:24847656-24847678 GCACGGGCTTCGGCGGCGGGCGG + Exonic
1182485145 22:30634988-30635010 GCCGGGGCTGGGGCACAGGGTGG + Intergenic
1182605145 22:31497003-31497025 TCCTGGGCCACGGAGCCGGGAGG - Intronic
1183307401 22:37089881-37089903 GGCTGGGCAGGGGAGCCGGGTGG + Intronic
1183358142 22:37370290-37370312 GCCTGGGCTGGGCCCCAGGGAGG - Exonic
1183432409 22:37773732-37773754 GCCTGGGCTGAGGGGCTGCGAGG - Intronic
1183437711 22:37805009-37805031 CCCTGGGCTTCCCCGCCGGGCGG - Intergenic
1183493146 22:38127407-38127429 GCCTGGGGTGCGGCGTCAGATGG - Intronic
1183504675 22:38202452-38202474 GGGTAGGCGGCGGCGCCGGGAGG + Intronic
1183606943 22:38871630-38871652 GGCTCGGCTGGGGCGCCGCGCGG - Intronic
1183702366 22:39457642-39457664 GAGTGGGCCGCGGAGCCGGGCGG - Intronic
1183704800 22:39469841-39469863 GCCGGGGCTGCAGGGCAGGGCGG + Intronic
1183726365 22:39592087-39592109 GGCTGTGCTGAGGCGCTGGGGGG + Intronic
1184243882 22:43226342-43226364 GCCAAGGCTGCGGCTCTGGGTGG + Intronic
1184607140 22:45580659-45580681 CCCTGGGCTCCGGCTCTGGGCGG - Intronic
1184644188 22:45887251-45887273 GCCTGGGCTCCGGCACCTTGGGG - Intergenic
1184843165 22:47064276-47064298 TCCCGGGCAGCGGTGCCGGGCGG + Intronic
1185027537 22:48424400-48424422 GCATGGGCAGCAGCTCCGGGCGG - Intergenic
1185172800 22:49303528-49303550 GCGTGGGTGGCGGTGCCGGGAGG + Intergenic
1185199572 22:49493459-49493481 GCCTGGGCTGCTGCCCTGGGAGG + Intronic
1185274303 22:49943773-49943795 GCCTGGGCGGCGGGGTGGGGGGG - Intergenic
1185289478 22:50016357-50016379 GCCTGGGCTGGGGCTCCTGGTGG + Intronic
1185292015 22:50031968-50031990 GCCAGGGCCGTGGCGCCGTGTGG - Exonic
1185337610 22:50277765-50277787 GCCGGGGCTGGGCCGCGGGGTGG + Intronic
1185337628 22:50277816-50277838 GCCGGGGCTGGGCCGCGGGGTGG + Intronic
1203254376 22_KI270733v1_random:131315-131337 GCCGGGGCGGGGGCGCGGGGAGG - Intergenic
1203262432 22_KI270733v1_random:176394-176416 GCCGGGGCGGGGGCGCGGGGAGG - Intergenic
950043322 3:9933794-9933816 CCCTGGACTGCGGCGCGGGTGGG + Intergenic
950518153 3:13480506-13480528 GGCTGGCCTGGCGCGCCGGGAGG - Intronic
950563339 3:13748831-13748853 GCCTGGGCCGGGGTGCAGGGAGG + Intergenic
950650305 3:14402913-14402935 GCCGGGACTGCGGCGACGCGGGG - Intronic
950666175 3:14496479-14496501 GCCTTGGCAGAGGGGCCGGGAGG - Exonic
950724294 3:14906451-14906473 GCCTGGGCTGTGGGGGTGGGAGG + Intronic
950902970 3:16513570-16513592 GCGTGGGCGGTGGCGCCGCGTGG + Exonic
951411526 3:22372531-22372553 GCCAGGGCCAGGGCGCCGGGCGG - Intronic
951728397 3:25783804-25783826 GCCTGGGCTCCGGGGCTGAGGGG + Intronic
952377804 3:32781579-32781601 GCCGGCGCGGCGGCGCCGGGCGG + Intergenic
954382571 3:50227434-50227456 GCGGGGGCTGGGGCGCGGGGAGG + Intronic
954615722 3:51967823-51967845 GGCTCGGCAGAGGCGCCGGGCGG - Intronic
954796092 3:53161901-53161923 GCCGGGGGCGCGGCTCCGGGAGG - Intronic
955195529 3:56801946-56801968 GACTGGGCTCCGGAGCCGAGTGG + Intronic
956179101 3:66501028-66501050 GCCGGGGCTGGGCCGCGGGGAGG - Intronic
956979057 3:74614885-74614907 CCCTGGGCGGCGGCGCGGGCTGG + Intergenic
957732688 3:84161823-84161845 GCCAGGGCTTGGGGGCCGGGGGG - Intergenic
960937724 3:122913528-122913550 GCCTGGGCTGCGGCGTGGTGAGG - Exonic
961402977 3:126660177-126660199 GCCAGGGCTGCAGCGGCAGGTGG + Intergenic
961446341 3:126983344-126983366 GGCTGGGGTCCGGGGCCGGGCGG + Intergenic
962770878 3:138609083-138609105 CTCTGGGCGGCGGCGGCGGGCGG + Intronic
963091561 3:141487466-141487488 GCCCGGGCTGCGCCGGCGTGAGG + Intronic
963236795 3:142963861-142963883 GCCCGGGCTGCGGCGGCCCGAGG - Intergenic
963870690 3:150410394-150410416 GCTGGGGCTGCTGCGCCGCGGGG - Exonic
965757618 3:172040875-172040897 GACTGGGCTGCGCCGCCCGGCGG + Intronic
966874517 3:184314754-184314776 GCCGGGGCGGCGGCGCAGGGTGG - Intronic
968084776 3:195869398-195869420 GCCTGGGCGGCTGGGCCGGAGGG - Intronic
968323508 3:197791717-197791739 GCCTGGGGAGAGGCGGCGGGCGG + Intronic
968517789 4:1022144-1022166 GCTTGGGGTCCGGAGCCGGGGGG - Intronic
968588980 4:1448433-1448455 GCCTGGGCTGGGGCCCCAAGGGG - Intergenic
968645503 4:1738492-1738514 GCCTGGGCTCCGGGGGCAGGTGG + Intronic
968659641 4:1793710-1793732 CCCTGGGCGGCGGCGGCGGCGGG + Intronic
968942911 4:3648418-3648440 TCCTGAGCTGCGGAGGCGGGCGG - Intergenic
969113374 4:4857076-4857098 GCCTGGACTCCGCCGCGGGGGGG - Intergenic
969115011 4:4865969-4865991 ACCCGGGCTGCGGCGCAGGGAGG - Intergenic
969699982 4:8762549-8762571 GCCTGGGCAGCGGCACCCTGTGG - Intergenic
972671062 4:41214425-41214447 GCCTCGGCTCCGGCGCCCAGCGG + Exonic
973684379 4:53354413-53354435 GCCTGCACTGCGGCGCTGGCAGG - Intronic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
979565725 4:122152412-122152434 ACCTGGGCGGCGGCCCCGGGCGG + Exonic
979832415 4:125317750-125317772 GCCTGGACTGCTGCGCCAGGGGG - Exonic
981432514 4:144677683-144677705 GCCTGGACTCCGGCTCCGAGTGG - Intronic
985537538 5:473487-473509 GCCTGGGGTGCGCCGCGGGAGGG - Intronic
985544823 5:504365-504387 GCCCTGGCTGCAGCCCCGGGGGG - Intronic
985553091 5:543111-543133 GGCTGGGCTGCAGGGCCAGGTGG + Intergenic
985844596 5:2334903-2334925 GCCTGGGCAGCGGGCCCGGCAGG - Intergenic
986106259 5:4662289-4662311 TCCTGGGCTGCTGCTCCGGTTGG - Intergenic
989178857 5:38556638-38556660 GCCGGGACTGCGGCGCGCGGGGG + Intronic
990454135 5:55968075-55968097 GCATGGGCCGCCGCGCCTGGGGG + Intronic
991371746 5:65926177-65926199 TCCTCGGCTCCGGCTCCGGGTGG + Intergenic
993168353 5:84384578-84384600 GCCTGCGCTCCGGCGCGCGGAGG + Exonic
993386468 5:87268274-87268296 GCCTGGGCTGTGGCCCTAGGAGG + Exonic
997583979 5:135034036-135034058 CCCGGGGCTGCGGCGCCGGGCGG + Exonic
997635159 5:135399203-135399225 CACTCGGCAGCGGCGCCGGGCGG - Exonic
997965521 5:138353017-138353039 GCCGGGGCTGCGGGGCCTGCGGG + Intronic
998150775 5:139756331-139756353 GCCGGGGCCGCGGCGCTGGAGGG + Intergenic
998203942 5:140146064-140146086 GGCTGGTCTGCGGCGGCGGAGGG - Intergenic
998406686 5:141878281-141878303 GCCTGGGCTGCGGCTCCGCACGG + Exonic
999248195 5:150166717-150166739 GCCTCGGCTGGGGCCGCGGGCGG + Intergenic
1002162106 5:177320476-177320498 GCCTGGGCAGCAGCTCCGGGAGG - Intergenic
1002512742 5:179733341-179733363 GCCGGGGCCGTGGCGGCGGGCGG - Exonic
1002888154 6:1313376-1313398 GCCCGGGCTGCGGCCCGAGGAGG + Exonic
1002896621 6:1383584-1383606 GGGCGGGCTGCGGCGGCGGGAGG - Intergenic
1002927871 6:1615107-1615129 GCCGGCGCTGCGGCCCCAGGCGG + Intergenic
1003409689 6:5851459-5851481 GCGTGGGCACCGGCGCGGGGCGG - Intergenic
1003874240 6:10422494-10422516 GCCTGAGCTGCGGTGAGGGGCGG + Intergenic
1005851734 6:29827988-29828010 GACTCGGCAGCCGCGCCGGGAGG + Intronic
1005905573 6:30259756-30259778 GCCCGGGGAGCCGCGCCGGGAGG + Intergenic
1006228206 6:32558475-32558497 GCACGGGCTGCGGCGCTCGGTGG - Intronic
1006230817 6:32584665-32584687 GCGCGGGCTGCGGTGCTGGGCGG - Intronic
1006256866 6:32838820-32838842 TTCTGGGCTGGGCCGCCGGGAGG + Exonic
1006396037 6:33788498-33788520 GCCTGAGGTGGGGCGCCGGCTGG - Exonic
1006475272 6:34248978-34249000 GTCGGGGCTGCAGCGGCGGGAGG - Exonic
1006665218 6:35688670-35688692 TCCTGGGCTGCGAAGCCGCGTGG + Intronic
1007421659 6:41723508-41723530 CCCTGGGCTCCGGCCCCTGGAGG - Intronic
1008092841 6:47309706-47309728 GCCTGGGCGGCCGCGCCGCTGGG - Exonic
1011226615 6:85114983-85115005 GCGGGGGCGGGGGCGCCGGGGGG + Intergenic
1011765136 6:90611470-90611492 CCCAGGGCTTAGGCGCCGGGCGG + Intergenic
1012062962 6:94511476-94511498 GCCGGGGGTGGGGCGCGGGGAGG - Intergenic
1013226070 6:108119968-108119990 GCCTAGGCCGGGGCGCCGTGCGG - Intronic
1015289759 6:131525262-131525284 GGCTGGGCTTCTGCGTCGGGTGG - Intergenic
1015494487 6:133865862-133865884 GCCTGGGCAGGGGCGGCTGGAGG + Intergenic
1016827867 6:148404807-148404829 GCCTGGGCTGGGGCTGGGGGTGG - Intronic
1017163846 6:151390512-151390534 GCCGGGGCTGTTGCGCCGGCCGG - Intronic
1017164128 6:151391425-151391447 GCCGGTGCTGCTGCGGCGGGGGG + Exonic
1017816114 6:158017820-158017842 GCCTGTGCTGGGGAGCAGGGTGG + Intronic
1017877667 6:158537277-158537299 GCGCGCGCTGCGGCGTCGGGAGG + Intronic
1018429152 6:163709843-163709865 GCCAGGGCTGTGGCCCAGGGAGG + Intergenic
1018613054 6:165662157-165662179 GCCGGGGCGGCGGCGGCGGCCGG + Intronic
1019161933 6:170074721-170074743 GCCTGGGCCTGGGAGCCGGGTGG + Intergenic
1019299154 7:294883-294905 GCCTGGACTTGGGGGCCGGGCGG - Intergenic
1019312295 7:368775-368797 CTCTGTGCTGCGGCCCCGGGAGG - Intergenic
1019421903 7:954556-954578 GCAGGGGCGGCGGCGGCGGGCGG - Intronic
1019485931 7:1289188-1289210 TCCGGGGCTGCGGGGACGGGAGG - Intergenic
1019652587 7:2168493-2168515 GCCTGGGCTGTGGCCCCAGCTGG + Intronic
1019676283 7:2314456-2314478 GGCAGGGCTGCGCGGCCGGGTGG - Exonic
1020125310 7:5530029-5530051 GCCTGGGCTGGGGCGAAGGCGGG - Intronic
1020126056 7:5532983-5533005 GCCTGGGGTGAGGGGCAGGGAGG + Intronic
1020418281 7:7969681-7969703 GCCGGGGCTGCGGCCGCCGGCGG - Exonic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1021845301 7:24757456-24757478 GCCTGCGCTGGGCCGGCGGGGGG + Intronic
1023220581 7:37916964-37916986 CCCTGGGCTGCGGCCCAGAGGGG - Intronic
1023381159 7:39609811-39609833 GCCTGGGGCCCGGAGCCGGGCGG - Intronic
1023831361 7:44040517-44040539 GACTGGGCTGGGGCGAGGGGCGG - Intergenic
1024198408 7:47082460-47082482 GCTTGGGCAGTGGGGCCGGGTGG + Intergenic
1024580022 7:50793571-50793593 GTCCGGGCGGCGGCGGCGGGAGG - Intergenic
1024741767 7:52362750-52362772 CCCTGGGCGGCGGGGCCGGCTGG - Intergenic
1026968291 7:74453926-74453948 GCGCGGGCTGCGGCGGAGGGCGG - Intronic
1029419588 7:100466018-100466040 GCCTGGGCTCCGGTCCCAGGCGG - Intronic
1029664615 7:101987060-101987082 GCCTGAGCTGAGGCACAGGGAGG - Intronic
1029979276 7:104862893-104862915 GCTTGGGCTGCTCCGCCTGGTGG + Intronic
1031986571 7:128167771-128167793 GCCTGGGTTCGGGCGCTGGGAGG - Intergenic
1033099837 7:138460591-138460613 GCCTCGGCTGCGGCCTCCGGGGG + Exonic
1033226907 7:139569554-139569576 GCCTGGGATGCGACGTCAGGTGG - Exonic
1034531002 7:151696495-151696517 GTCAGGGCTGAGGCGCCGGCAGG - Intronic
1034985398 7:155509991-155510013 GCCCGGGCTGCGGCGCGGTCCGG - Intronic
1036453808 8:8891831-8891853 GCCGGGGCTGCACCGCCGGCTGG + Exonic
1037273808 8:17156737-17156759 GCCCGGGCAGCAGCGCCAGGCGG + Exonic
1037803665 8:22048314-22048336 GACTGGGCTGGGGTGGCGGGAGG + Exonic
1037865866 8:22441508-22441530 GGCTGGGCGGCGGCTCGGGGCGG + Intronic
1037876557 8:22551636-22551658 GGCGGGGAGGCGGCGCCGGGAGG - Intronic
1037887914 8:22604814-22604836 GCCAGGGCAGCGACACCGGGGGG - Exonic
1041690369 8:60680347-60680369 GGCTGGGCTGCGGTGCGGGGCGG + Intronic
1042040219 8:64581386-64581408 GCCTGGGCGGCGGCGGCGGCGGG + Exonic
1042916179 8:73878383-73878405 GCCGGGGCAGGGGCGGCGGGGGG - Intronic
1043372567 8:79611770-79611792 TCCTGGGGTGCGGTGCAGGGAGG + Intronic
1043753524 8:83970960-83970982 GCCTGGCGTGGGGCTCCGGGTGG + Intergenic
1045277484 8:100721321-100721343 GCTCGGGCGGCGGCGGCGGGCGG - Intronic
1045547418 8:103141003-103141025 TCCGGGGCGGCGGCGCTGGGCGG - Exonic
1049237320 8:141518769-141518791 GCCTGGGCGGCTGGGCCCGGCGG + Intergenic
1049419541 8:142510751-142510773 GCCCGGGCCGCGGGGCCTGGCGG + Intronic
1049452545 8:142669899-142669921 TCCTGGCCTGAGGCGCTGGGCGG - Intronic
1049620944 8:143598020-143598042 GCCCGGGCCGCGGCCCCGCGTGG + Exonic
1049654024 8:143789874-143789896 GCCTGGCATGGGGCGCCGGCTGG + Intergenic
1049756584 8:144313695-144313717 GGCGGGGCGGCGGCGCGGGGAGG - Intronic
1049788376 8:144462175-144462197 GCCAGGCCTGCGGGGCCCGGCGG - Intronic
1049860431 8:144894486-144894508 GCCAGGGCTGCTGCGGTGGGTGG - Intronic
1051774836 9:20622170-20622192 GTCTGGGCTGCGGCGGCGCAGGG + Intronic
1053239944 9:36487407-36487429 GCCGGGGCGGCGGCGGTGGGGGG + Intronic
1053435153 9:38069277-38069299 GGCGGGGCGGCGGCGCGGGGCGG - Intergenic
1057432230 9:95004939-95004961 GCCTGGGCGGCGGCGCGGGCGGG - Intronic
1057490471 9:95516297-95516319 GCCGGGGCCGTGGAGCCGGGTGG - Intronic
1057562773 9:96140961-96140983 GCTTGGGCTGCGGCCAGGGGAGG + Intergenic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1061231615 9:129319047-129319069 GCCAGGGCGGGGGCGACGGGGGG - Intergenic
1061248808 9:129414766-129414788 GCCTGGGCTGCCGGGCGAGGCGG + Intergenic
1061398298 9:130355199-130355221 GCCTGGGCTGTGGGGCCGGCAGG + Intronic
1061652431 9:132061698-132061720 GCCTGGGCTCTGGGGCCCGGTGG - Intronic
1061704690 9:132444018-132444040 GCCTGGCCTGTGGGCCCGGGAGG - Intronic
1061799408 9:133105810-133105832 GCGGGGGCTGGGGCGGCGGGCGG - Intronic
1062056839 9:134473161-134473183 GCCAGGGCTGTGGCGCTGTGAGG - Intergenic
1062208245 9:135348994-135349016 GCCTGGGCTGGAGCACAGGGAGG - Intergenic
1062276648 9:135734509-135734531 GCCTGGGGTGCGGGGAGGGGAGG - Intronic
1062277212 9:135736693-135736715 TCGGGGGCTGCGGCGCCGGCTGG - Intronic
1062454198 9:136628023-136628045 GCCAGGGCTGCGGCGCCACATGG + Intergenic
1062529163 9:136992394-136992416 GGCGGGGCTTGGGCGCCGGGAGG - Intergenic
1062536597 9:137023786-137023808 GCCTGGGCAGCAGCTGCGGGGGG - Intronic
1203470777 Un_GL000220v1:114459-114481 GCCGGGGCGGGGGCGCGGGGAGG - Intergenic
1203478598 Un_GL000220v1:158431-158453 GCCGGGGCGGGGGCGCGGGGAGG - Intergenic
1185459367 X:327821-327843 CCCTGGGCTGCAGCGCTGGCCGG - Intergenic
1187281381 X:17860795-17860817 GCCGGGGAGGCGGCGCCGGCCGG - Intronic
1189332869 X:40153913-40153935 GCGAGGGCTGCCGCGCCGTGGGG + Intronic
1190062301 X:47219175-47219197 GTCTGGGCTGCGGGGCTGGCAGG + Intronic
1191184136 X:57592210-57592232 GCCCGGGCGGCGGCGCGAGGAGG + Exonic
1191213252 X:57910237-57910259 GCCCGGGCGGCGGCGCGAGGAGG - Exonic
1196684090 X:118495954-118495976 GCCATGGCAGCGGCGGCGGGCGG - Exonic
1198815065 X:140580692-140580714 GCCTGGGCCGGGGTGCAGGGAGG + Intergenic
1199594246 X:149494062-149494084 GCCTGGGCTGCTGGGGCTGGAGG + Intronic
1199772597 X:150984040-150984062 GCGGCGGCGGCGGCGCCGGGCGG - Intronic
1200088683 X:153624380-153624402 GGCTGGGCTGGGCCACCGGGAGG + Intergenic
1200137136 X:153880652-153880674 GCCTGGGGAGCGGGGCGGGGAGG - Intronic