ID: 1126163512

View in Genome Browser
Species Human (GRCh38)
Location 15:45634917-45634939
Sequence CTGGGCTGCGGCGCCGGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 508}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163501_1126163512 3 Left 1126163501 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1126163512 15:45634917-45634939 CTGGGCTGCGGCGCCGGGCGGGG 0: 1
1: 0
2: 3
3: 64
4: 508
1126163500_1126163512 4 Left 1126163500 15:45634890-45634912 CCCTGGTGTGTTCACTGACCATG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1126163512 15:45634917-45634939 CTGGGCTGCGGCGCCGGGCGGGG 0: 1
1: 0
2: 3
3: 64
4: 508
1126163496_1126163512 22 Left 1126163496 15:45634872-45634894 CCCCGTGAGCGCTCAACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1126163512 15:45634917-45634939 CTGGGCTGCGGCGCCGGGCGGGG 0: 1
1: 0
2: 3
3: 64
4: 508
1126163499_1126163512 20 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163512 15:45634917-45634939 CTGGGCTGCGGCGCCGGGCGGGG 0: 1
1: 0
2: 3
3: 64
4: 508
1126163497_1126163512 21 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163512 15:45634917-45634939 CTGGGCTGCGGCGCCGGGCGGGG 0: 1
1: 0
2: 3
3: 64
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163512 Original CRISPR CTGGGCTGCGGCGCCGGGCG GGG Exonic
900154291 1:1197872-1197894 CACGGCTGGGGCGCGGGGCGCGG - Exonic
900159666 1:1217481-1217503 GTGGGGGGCGGCGCGGGGCGCGG + Exonic
900176801 1:1294679-1294701 CTGGGCAGGGGCCTCGGGCGAGG + Intronic
900413911 1:2526417-2526439 GCGGGCTGCGGGGGCGGGCGGGG - Intronic
901279851 1:8025915-8025937 CCGGGCTGCGCCGCCGGGGAGGG + Intronic
901805669 1:11736906-11736928 GTGGGCGGCGGGGCTGGGCGGGG - Intronic
901930813 1:12595437-12595459 CGGGGCTGCAGTGCCGGGTGGGG + Intronic
902470478 1:16645112-16645134 CTGGGCTCTGCCGCCGGGCGTGG + Intergenic
902536012 1:17119693-17119715 CTGGGCTGGGGCGTCCGGAGGGG - Intergenic
902584989 1:17433415-17433437 CGGGGCGGCGGGGCAGGGCGGGG + Intronic
902585635 1:17437701-17437723 CTCGGCTCCGGCGCCCGGGGGGG - Intronic
902691186 1:18110815-18110837 CTGTGCAGTGGCGCCGGGCTGGG + Intronic
903055548 1:20633689-20633711 CTGGGCCGCAGGACCGGGCGCGG + Exonic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903180194 1:21601475-21601497 CTGTGCTCCAGAGCCGGGCGCGG + Intronic
903187178 1:21635283-21635305 CTGGGCTGCGGAGGCTGGGGAGG - Intronic
903325647 1:22567233-22567255 CTGGGATGCGGGGTGGGGCGGGG + Intronic
903389364 1:22953410-22953432 GTGGGCGGCGGAGCCGGGCCGGG + Exonic
903788239 1:25875391-25875413 CGGGGCTGCGGGGCTGGACGTGG - Intergenic
903890184 1:26564546-26564568 GTGGGCAGCGTGGCCGGGCGCGG - Intronic
904252733 1:29236578-29236600 CTGGGCTCGGGCTCCGGGGGCGG + Exonic
904272095 1:29356804-29356826 CTGGGCAGGTGCGCAGGGCGAGG + Intergenic
904684002 1:32247810-32247832 CTGGGCTGAGGAGCCGGGAATGG + Intronic
904840399 1:33368541-33368563 CGGGGGTGGGGGGCCGGGCGGGG + Exonic
905031227 1:34885648-34885670 CGGAGCTGCAGCGCCGGGCGGGG + Exonic
905092443 1:35440454-35440476 CTGGGCTGGGTCACCTGGCGAGG - Intronic
905313430 1:37066156-37066178 CTGGGTGGGGGCGCCGGGAGAGG - Intergenic
905432056 1:37931630-37931652 CTGGGCTGGGGAGCTGGGCCGGG - Intronic
905639146 1:39576585-39576607 AAGCGCTGCGGCGGCGGGCGCGG + Intronic
905920040 1:41713195-41713217 CTGGGCTGGGGCGCAGATCGGGG - Intronic
906295435 1:44646403-44646425 ATGGGCCGCGGCGCAGGGCCCGG + Intronic
906317922 1:44800172-44800194 CCGGGCTGCGCCCCGGGGCGCGG + Intergenic
906520903 1:46466474-46466496 CGGGGCTGCAGCTCCCGGCGAGG + Intergenic
906637130 1:47417037-47417059 TGCGGCTGCGGCGTCGGGCGCGG - Exonic
910935177 1:92481145-92481167 CCGGGCTGCGGCTGCGAGCGTGG + Intronic
913994790 1:143643133-143643155 CTGGGCTGAGGCGCGGCACGCGG - Intergenic
914361438 1:146939160-146939182 GTGGGCTGCAGCGGCAGGCGAGG - Intronic
914803108 1:150974584-150974606 CGGGGCTCGGGCGCCGGGCGGGG + Intronic
915358850 1:155273420-155273442 CTGGGATCGGGCCCCGGGCGGGG - Intronic
915530801 1:156501000-156501022 CTAGGCTGCGGCGCTGGGAGCGG + Intergenic
917837418 1:178952464-178952486 GTGGGCTGCAGGGCCAGGCGCGG + Intergenic
919795798 1:201320802-201320824 CTGGGCTGTGGGGCAGGGCTCGG - Intronic
919810380 1:201405524-201405546 CTGGGCTGGGCAGCCGGGGGCGG - Exonic
919820419 1:201468835-201468857 CTGCGCTGCGGGGCCGAGAGGGG - Exonic
920229610 1:204461727-204461749 CTGGGCTGTGGGGCTGGGCCTGG + Intronic
920333386 1:205228155-205228177 CCGGGCTGCGGGGCGAGGCGGGG - Exonic
921743903 1:218715968-218715990 CTGGGCTTCTGGGTCGGGCGGGG - Intergenic
921934800 1:220786776-220786798 CTGGGGGGCGGCGCGGGGAGTGG - Exonic
922766241 1:228158091-228158113 CCGGGCGGCGGCGGAGGGCGCGG - Exonic
923506308 1:234609261-234609283 CGAGGCCGCGGCGCCGGGTGGGG + Exonic
923744359 1:236686637-236686659 CGGGGCTGCGGCGGGGCGCGAGG - Exonic
924052293 1:240091774-240091796 GGGGGCGGCGGCGGCGGGCGGGG + Intronic
1063504021 10:6580180-6580202 CCCGGCGGCGGCGCGGGGCGCGG + Intronic
1063623378 10:7667666-7667688 CCGGGAAGCGGCGCCGGGCGGGG - Intergenic
1064230872 10:13528764-13528786 CCGGGAGGCGGCGCCGCGCGGGG - Intronic
1064254044 10:13729092-13729114 CTTGGCCGCGGGGGCGGGCGGGG - Intronic
1064418356 10:15169027-15169049 AGGGGCTGCGGCGGTGGGCGGGG - Intergenic
1064443211 10:15371383-15371405 CGACGCAGCGGCGCCGGGCGGGG - Intergenic
1065020785 10:21500380-21500402 CCGGGCCGCGCAGCCGGGCGAGG + Intergenic
1065025227 10:21534532-21534554 GTGGGCTGCCGGGCCGGGCGGGG + Intronic
1065099472 10:22320466-22320488 CGGGGCTCCGGGGGCGGGCGCGG + Intronic
1066080843 10:31928959-31928981 AGGGGGTGCGGCGCCCGGCGGGG + Intergenic
1067343017 10:45419505-45419527 CTGGCCTGCGGGGCTGGGGGAGG - Intronic
1067567541 10:47349680-47349702 TTCGGCTGCAGCGTCGGGCGCGG - Exonic
1069280855 10:66651741-66651763 CTGGCCTGCGGCTCCGAGTGCGG + Intronic
1069778294 10:70939419-70939441 CTGGGCTGCAGAGCCAGGCCAGG + Intergenic
1070458718 10:76643614-76643636 CTGTGCTGAGGCGCCGGGGCAGG - Intergenic
1071545926 10:86529294-86529316 CTAGGCTGGGCGGCCGGGCGTGG - Intergenic
1072562184 10:96586703-96586725 CGGGGCGGCCGCGCCGGCCGGGG + Intronic
1072636137 10:97179801-97179823 CTGGGCTGTGCCGGGGGGCGGGG - Intronic
1073178513 10:101570432-101570454 CCGGGCTGCGGGGCCTGGCTGGG - Intergenic
1073479794 10:103779317-103779339 CTGGCATGAGGCGCCGTGCGGGG + Intronic
1074586053 10:114768363-114768385 CTCTGCCGCGGCGCCGGGCGGGG + Intergenic
1075401534 10:122164365-122164387 CTGGGCTGTCGCCCCGGGCACGG - Intronic
1075501732 10:122980717-122980739 CTGGGCCGCGGGGCGGGGCGGGG + Intronic
1076606977 10:131695491-131695513 CAGGGCTGAGGCTCAGGGCGGGG + Intergenic
1076792852 10:132786044-132786066 GTCGGCTGCAGCGCGGGGCGCGG + Exonic
1076892030 10:133289640-133289662 CTGGGCTGCGGCGCTGAGTTAGG - Intronic
1076985976 11:236364-236386 CGGGGCCGGGGCGCCGGGGGCGG - Exonic
1076985996 11:236403-236425 CGGGGCTGGGGCGCCGGGGGCGG - Exonic
1077041132 11:523640-523662 CGGGGTTGGGGGGCCGGGCGCGG + Intergenic
1077101288 11:823731-823753 CTGGGCCGTGGGGGCGGGCGGGG - Exonic
1077185149 11:1232402-1232424 GTGGGCTTCGGGGCAGGGCGTGG + Intronic
1077922971 11:6655481-6655503 CTGGGCTGCGGCAGCGGCGGCGG - Intronic
1078375901 11:10792726-10792748 CAGGGCTGCGGGGCGGGGCAGGG + Intergenic
1079428212 11:20363817-20363839 CGGGCCTGCGGCGCTGAGCGCGG + Exonic
1081938138 11:46918595-46918617 CGGGGCTGCGGCGCGGGGGGCGG - Exonic
1082983413 11:59144917-59144939 CTGGGGTGCTCCGCGGGGCGCGG + Exonic
1083227689 11:61295068-61295090 CTCGGCTCCTGCGCCGCGCGCGG + Exonic
1083322096 11:61854114-61854136 CTGGGCTGCGGCCAAGGGTGTGG - Intronic
1083778827 11:64907598-64907620 CTGGGCGGCGGGGTCGGGGGTGG + Exonic
1083885742 11:65572684-65572706 CTCGGCAGAGGCGCCGGGCGGGG + Exonic
1083886516 11:65576003-65576025 CGGGGCTCCGGCGCGGGGCGGGG - Intergenic
1083994442 11:66265251-66265273 CTGGGCTGGGGAGCAGGGCACGG + Intronic
1084973064 11:72781788-72781810 CGGGGCTGGGGCCCGGGGCGGGG - Intronic
1085266654 11:75241446-75241468 CTGGGCGGCGGCGCCTTCCGCGG + Exonic
1085485603 11:76860773-76860795 CTGGGCCGCGGGGCCGGGCCAGG - Intergenic
1087795666 11:102452817-102452839 CGGGGCGGCGGGGCCGGGCTGGG + Exonic
1088172967 11:107018276-107018298 CTCGGCGGCGGCGCCGGGCTGGG + Exonic
1089505365 11:118958636-118958658 CTGGGCTGTGGGGCAGGGAGGGG - Intergenic
1089694910 11:120211041-120211063 CGGGGCCGCGGAGCCGGGCCGGG + Exonic
1090345026 11:126062755-126062777 CGGGGCTGGGGCGCTGGGCAGGG + Intronic
1090817761 11:130314377-130314399 GCGGGCGGCGGCGCCGGGCCCGG + Exonic
1091286640 11:134411986-134412008 CGGGGCGGCGGGGCCGGGCGGGG - Intergenic
1091550244 12:1530853-1530875 CTGCGCTGGGTCGGCGGGCGAGG - Intronic
1091807352 12:3365998-3366020 GTGGGGTGGGGCGCCGGGGGCGG - Intergenic
1092143584 12:6200230-6200252 CTGGGCGGGGGCGGGGGGCGGGG + Intronic
1092239559 12:6828590-6828612 CGGGGCTTGGGCGCCGGCCGTGG + Exonic
1092250255 12:6891145-6891167 CTGGGCGGCTGCGCGGGGCGGGG - Intronic
1095667553 12:44820004-44820026 CTGGGCTGGGGCACCAGGTGAGG - Intronic
1096118437 12:49070018-49070040 CTGGGGGGCGGAGCCCGGCGCGG - Exonic
1096156888 12:49346001-49346023 CTGAGCTGTGGTGCGGGGCGCGG - Intergenic
1096466166 12:51848604-51848626 CGGGGCGGCGGCGCGGGCCGGGG + Intergenic
1096482455 12:51951707-51951729 CTGGGCTGCGGCGGCGGCGGCGG + Exonic
1096489665 12:52006813-52006835 CAGGGCGGCGGCGCCTCGCGGGG + Intergenic
1097676093 12:62603538-62603560 CTGGGCGGGGTCTCCGGGCGCGG + Exonic
1097854935 12:64452242-64452264 CAGGCCTGCGCCGCCCGGCGGGG + Intronic
1098029007 12:66235292-66235314 GCGGGCCGCGGCGGCGGGCGCGG + Intronic
1100315620 12:93441981-93442003 GGCGGCTGCGGCGACGGGCGCGG - Exonic
1101910513 12:108857494-108857516 CATGGCTGCGGCGCGGTGCGAGG + Exonic
1101970618 12:109309751-109309773 GGGGGCTGCGGAGCGGGGCGCGG + Intergenic
1102084387 12:110124266-110124288 CTGGGGGGCGGGGCCGGGCCAGG - Intergenic
1102300355 12:111766887-111766909 ATTGGCTGCCGCGCGGGGCGGGG + Intronic
1102520075 12:113472473-113472495 CTGGGCTCGGCGGCCGGGCGGGG - Intergenic
1102570256 12:113823124-113823146 GTGGGCTGGGGGGCGGGGCGGGG - Intronic
1103381279 12:120496082-120496104 CTAGGCGGCGGCGGCTGGCGTGG + Intronic
1103415959 12:120741600-120741622 CAGCGCTGCCTCGCCGGGCGGGG - Intergenic
1103899227 12:124294984-124295006 CTCGGCGGAGGCGCCGGGCCGGG + Intronic
1104136494 12:125944612-125944634 CTGGACTGTGGTGCAGGGCGGGG + Intergenic
1104854293 12:131894877-131894899 CGGGGGCGCGGGGCCGGGCGAGG - Exonic
1104980283 12:132570489-132570511 CTGGCCGGCAGCGCCGGGGGCGG - Exonic
1104983380 12:132583606-132583628 GAGGGCGGCGGCGGCGGGCGGGG - Exonic
1105745443 13:23373608-23373630 ATGGGAGGCGGCGCGGGGCGGGG - Intronic
1106250483 13:27978531-27978553 CGGGGCAGGGGGGCCGGGCGCGG - Intronic
1106340145 13:28819899-28819921 CGGAGCTGCGACGCGGGGCGCGG + Intergenic
1106516978 13:30464820-30464842 CGCGGCGGCGGCGGCGGGCGGGG + Intronic
1107133316 13:36919662-36919684 CGGGGCTGGGGCCCGGGGCGTGG - Intronic
1110705938 13:78602178-78602200 CCGGGCGGCGGCCCCGGGGGAGG - Exonic
1111265563 13:85807850-85807872 CTGGGCTGCACAGCCGGGTGCGG + Intergenic
1112261204 13:97879935-97879957 CTGGGCTGAGGGGCCTGGCAAGG - Intergenic
1112290838 13:98143155-98143177 CTCGGCTGGGGCGCGGGGCGGGG + Intronic
1112580691 13:100674566-100674588 CTGAGCTGCGGCCCGGGCCGGGG - Intronic
1113346700 13:109485316-109485338 CGGGGCAGGGGCGGCGGGCGGGG - Intergenic
1113379213 13:109787007-109787029 CGGGGAGGGGGCGCCGGGCGGGG + Intergenic
1115028404 14:28767511-28767533 GGGGGCTGCGGTGCCGGGGGCGG - Exonic
1115592211 14:34874965-34874987 CCTGGCGGCGGCGGCGGGCGAGG - Intronic
1115651254 14:35404236-35404258 CAGGGCTGCAGGGCCGCGCGGGG - Intronic
1116186610 14:41606982-41607004 CGGGGCTGCGGCCGCGGCCGGGG - Intergenic
1118610101 14:67533239-67533261 GTGGGCTGCGGGGCGGGGCGAGG - Intronic
1119539373 14:75428412-75428434 CCCGGCTGCAGCGCCCGGCGCGG - Intronic
1121050489 14:90816448-90816470 GCGGGCGGCGGCGGCGGGCGCGG + Intronic
1121368029 14:93332668-93332690 AGGCGCTGGGGCGCCGGGCGGGG - Intronic
1122145075 14:99684165-99684187 CTGGGGGGCGGGGCGGGGCGGGG + Intergenic
1122265902 14:100546687-100546709 CCGGGCCGCGGCGCTGAGCGGGG + Intronic
1122582020 14:102777233-102777255 CGGCGCCGCGGCGCGGGGCGGGG - Intergenic
1122621064 14:103057760-103057782 CTGGGGAGCGGCGCGGGGTGGGG + Intergenic
1122624098 14:103075438-103075460 CTCGGCTCCGGCGCGGAGCGGGG - Intergenic
1122835235 14:104427560-104427582 CTCGGCTGCGTGGCCGGGGGTGG - Intergenic
1122961005 14:105093595-105093617 CTGGGCTGCGCCGCCGCAGGCGG + Intergenic
1202865525 14_GL000225v1_random:114727-114749 GTGGGCTGCGTCTCCGGGCCAGG + Intergenic
1124248893 15:28094904-28094926 CCAGGGCGCGGCGCCGGGCGTGG + Intronic
1124469191 15:29968500-29968522 CTTGGCTGCTGCGCCCCGCGCGG + Intronic
1126163512 15:45634917-45634939 CTGGGCTGCGGCGCCGGGCGGGG + Exonic
1126724974 15:51622727-51622749 CCGGGCGGCGGCGGCGGTCGAGG - Intronic
1128153554 15:65377874-65377896 CGGGGCTGGGGCTCCGGCCGGGG + Exonic
1128369420 15:67029506-67029528 ATGGGCTACGGGGCAGGGCGCGG - Intergenic
1128648593 15:69394714-69394736 CTGGGCTGTGGGGCCGCACGTGG + Intronic
1129503263 15:76059966-76059988 CTCTGCAGCGGCGCCGGCCGCGG - Exonic
1129606544 15:77027980-77028002 CTGGGCTGTGGCCCCGGGCAGGG + Intronic
1129710989 15:77820114-77820136 GGGGGCGGCGGGGCCGGGCGTGG - Intronic
1130076690 15:80695617-80695639 CTGGGCCGCGGCGGCGGCGGCGG - Exonic
1130531134 15:84748546-84748568 CGGGGCTGCGGCTCCGGGGGCGG - Intergenic
1130975427 15:88769824-88769846 CCAGGCTGCCGCGCCGGCCGCGG - Intergenic
1131969325 15:97875949-97875971 CTGGGCTTCTGGGTCGGGCGGGG + Intergenic
1132231579 15:100188365-100188387 CAGGGCTTCGTGGCCGGGCGTGG - Intronic
1132368657 15:101277420-101277442 CTGGGCGGCGGCGGCGGCGGCGG - Exonic
1132508572 16:325104-325126 CTGGGGTGCGGGGCCGCCCGCGG - Intronic
1132508587 16:325145-325167 CTGGGGTGCGGGGCCGCCCGCGG - Intronic
1132566853 16:627503-627525 CTGGCCAGCGGGGCCGGGGGCGG + Exonic
1132585834 16:705472-705494 CCGGGCTGCGGGGCCGGGAGGGG - Intronic
1132641807 16:981580-981602 ACGTGGTGCGGCGCCGGGCGGGG + Intergenic
1132665543 16:1079914-1079936 GTTGGCTGCGGCGCGGTGCGCGG - Exonic
1132674135 16:1114684-1114706 CTGGCCTGAGGCCCCGGGTGTGG - Intergenic
1132719777 16:1309882-1309904 CTCGGCCGCGGCGCGGGGCCCGG - Intronic
1132728995 16:1351538-1351560 CAGGGCAGCGCCGCCGGGCCCGG + Exonic
1132828935 16:1918283-1918305 CTGGGCGGCGGGGCCGGGGGCGG - Exonic
1133020776 16:2966065-2966087 ATAGGCTGCGGGGCCGGGCCTGG + Intronic
1133121560 16:3611696-3611718 TTCCTCTGCGGCGCCGGGCGCGG + Intergenic
1133188034 16:4114612-4114634 CAGGGCCCCGGCTCCGGGCGAGG + Exonic
1133188520 16:4116576-4116598 TGGGGCTGCGGGGCGGGGCGGGG + Intergenic
1133211130 16:4264005-4264027 CGGGGCTGCGGCTTCGGGTGGGG - Intronic
1134831242 16:17325105-17325127 CTGGGCGGGGGTGCCGGGCACGG + Intronic
1135135471 16:19883659-19883681 GTGGGCTGGGGCCCCAGGCGGGG + Intronic
1135821862 16:25692299-25692321 CTGGGCAGCGGCGGCGGCGGCGG + Exonic
1136399764 16:30010951-30010973 CTGGGCGGCGGCGGCCGGCGAGG + Exonic
1136550476 16:30979974-30979996 GAGGGCGGCGGCGCCGGGCGTGG - Exonic
1138532094 16:57639984-57640006 CTGGGCTGCAGGGACGGGTGTGG - Intronic
1139878886 16:70167756-70167778 CCGGGAGGCGGAGCCGGGCGCGG + Intergenic
1140373632 16:74427737-74427759 CCGGGAGGCGGAGCCGGGCGCGG - Intergenic
1141116692 16:81315334-81315356 CGGGGCGGCCGGGCCGGGCGTGG + Intronic
1141430575 16:83968622-83968644 CCGGGCGGCGGCGGCGGGCGCGG + Exonic
1141682670 16:85553528-85553550 CTGGGAGGGGGCGCCAGGCGGGG + Intergenic
1141840118 16:86568557-86568579 CCGGGCTGCGGCGTCGGCTGGGG - Exonic
1142029860 16:87833122-87833144 CTGGGCAGCGGCGCTGGGTTTGG - Intronic
1142188595 16:88706576-88706598 CTGGGCCGCGGCGCCGGGGGCGG - Exonic
1142221461 16:88856946-88856968 CTGGGCTGCGGGGCGGGGCCTGG + Exonic
1142293364 16:89202641-89202663 CTGGTCCGCGGAGCAGGGCGGGG - Intergenic
1142585695 17:971883-971905 GTGAGCTGCGGCGCCCGGCCAGG - Intronic
1142623811 17:1180136-1180158 CGGGGCTCCGGCGCTGGGCGAGG + Intronic
1143063352 17:4222197-4222219 GGGGGCGGCGGCGCCAGGCGCGG - Intronic
1143078807 17:4366445-4366467 CCGGGCTGAGGCGGCGGGAGCGG + Exonic
1143135608 17:4710774-4710796 ATGGGCGGCGGCTCGGGGCGGGG + Intronic
1143150817 17:4807008-4807030 CTGGGCGGCGGGGCGGGCCGAGG + Intergenic
1143565290 17:7717211-7717233 CGGGGGGGCGGCGCGGGGCGGGG - Intergenic
1143742666 17:8965715-8965737 CTGGGCTCCTCCGGCGGGCGGGG + Intergenic
1144263799 17:13548624-13548646 CTGGGCTTCTGGGTCGGGCGGGG + Intronic
1144342048 17:14318180-14318202 CTGGCCTGGGGAGCCGAGCGGGG - Intronic
1144758643 17:17694817-17694839 CGGGGCCGCGGGGCGGGGCGGGG + Intronic
1144847083 17:18225640-18225662 GCGGGCGGCGGCGGCGGGCGAGG + Exonic
1144849644 17:18237595-18237617 CAGGGCAGCGGCCCCGTGCGTGG - Exonic
1145014403 17:19387229-19387251 CGGGGCTGGGGCGGCTGGCGGGG - Intronic
1146053017 17:29567502-29567524 CGGGGTTGCGGGGCCGGGCGGGG - Intronic
1146058718 17:29593583-29593605 CGGGGCCGCGGCGCCCGGCCGGG - Exonic
1146256091 17:31392128-31392150 CTGGGCTCCGGCGGAGGGAGGGG - Intronic
1147183651 17:38702360-38702382 CTCGGCTCCGGCGGCGGCCGCGG + Intergenic
1147311595 17:39599105-39599127 CTGGGGCGCGGCGCAGGGGGAGG - Intergenic
1147686217 17:42288305-42288327 CCGGCGGGCGGCGCCGGGCGTGG - Exonic
1147719825 17:42532206-42532228 CTGGGCGGCGGCGGCGGCGGCGG - Intergenic
1147907641 17:43833194-43833216 TGCGGCTGCCGCGCCGGGCGGGG + Intergenic
1148000702 17:44385464-44385486 AAGGGCTGCGGCGCTGGGGGCGG + Intronic
1148048712 17:44759076-44759098 CGGGGGCGCGGGGCCGGGCGGGG - Exonic
1148578117 17:48725448-48725470 CTTGGCTGCGGCGGCCGCCGCGG + Exonic
1148865303 17:50625240-50625262 GTGGGCTCTGGGGCCGGGCGCGG - Intronic
1149610313 17:57954757-57954779 CTGGGCGGCGACGGCAGGCGGGG - Intronic
1149614814 17:57988434-57988456 CTGGGGTGGGGCCCGGGGCGGGG + Intergenic
1149655546 17:58308058-58308080 CTGGGCCGAGGCTCCGGGAGAGG - Intronic
1149990941 17:61383218-61383240 CTGGGCTGTAGGGCCGGGCCAGG + Intronic
1150830096 17:68511801-68511823 CTGCGCTGCGGGGCCGAGCGCGG - Intronic
1151577873 17:74962051-74962073 CTGGGCTGGGGCGCTGGGCTGGG - Intronic
1151674090 17:75589097-75589119 CTGGGAAGCGGCGCCTGGCGGGG - Intergenic
1151938880 17:77280972-77280994 CCGGGCGGCCCCGCCGGGCGAGG - Intronic
1151938951 17:77281175-77281197 CTGGTCTGCGCTGCCGCGCGGGG + Intronic
1152468357 17:80477705-80477727 CCGGGTTCCGGCGCCGGGCTGGG + Intronic
1152488014 17:80608181-80608203 CTGTGCTGCGCCGTCGGGCAGGG - Intronic
1152924067 17:83079614-83079636 CTCGGCGGCGGCGGCGGGCGCGG + Intergenic
1153382495 18:4454977-4454999 CCGGGCTGCGCCGCGGGGCTGGG - Intronic
1153615415 18:6929449-6929471 CTGGGCGGGGACGCTGGGCGGGG - Intergenic
1153855120 18:9137281-9137303 CTGGGCGGGGGCGCTGCGCGGGG + Intronic
1154202308 18:12308127-12308149 CCGGGCCGCGGCGTCGAGCGGGG + Exonic
1155144923 18:23075510-23075532 CTGGGCTGCAGCTCCAGGCTGGG + Intergenic
1156171704 18:34493859-34493881 CTGTGCGCCGGCGCCGGCCGCGG + Intronic
1156489000 18:37485441-37485463 CCGGGCGGCGGCGCGGCGCGCGG - Intronic
1160540476 18:79617674-79617696 CCATGCTGCGGCCCCGGGCGAGG - Intergenic
1160729070 19:632522-632544 CTTGGCGGCGGGGCCGGGGGGGG + Intronic
1160790592 19:921339-921361 GTGGGATGAGGCCCCGGGCGCGG - Intergenic
1160818851 19:1048877-1048899 CTGGCCTGCGGGGAGGGGCGCGG - Exonic
1160891491 19:1380954-1380976 CTGGGCTGCTGCCCCCAGCGAGG - Intergenic
1160932678 19:1578068-1578090 CTGGGCTTCGCCGCCGAGCCTGG + Exonic
1160935482 19:1592656-1592678 CCGGGCGGCGGCGGCGGGCCCGG - Exonic
1160983635 19:1827706-1827728 CTGGGCTGGGGAGGCGGGCTTGG + Exonic
1160991765 19:1863123-1863145 CTTGGCGGCGGCGGAGGGCGCGG + Exonic
1161108705 19:2456639-2456661 CGGGGCTTAGGGGCCGGGCGGGG - Intronic
1161203460 19:3028647-3028669 CTGGGCGCCGGGGCGGGGCGAGG - Intronic
1161304158 19:3557605-3557627 CCGGGCGACTGCGCCGGGCGGGG + Intronic
1161333754 19:3700215-3700237 CGGGGCTGCGGGGCCGGGGCGGG - Intronic
1161450636 19:4343616-4343638 CGGGGCGGAGGCGCGGGGCGCGG + Intronic
1161581736 19:5084858-5084880 GTGGGCCGGGGCGGCGGGCGGGG - Intronic
1161583927 19:5094975-5094997 CTCGGGGGCGGCGCCGGGGGCGG + Intronic
1161990555 19:7681753-7681775 CTGTGCTGGAGCGCAGGGCGGGG + Intronic
1162131108 19:8526685-8526707 CTGCGCTTCGGCCCCGGCCGCGG - Intronic
1162566242 19:11446983-11447005 CCGGGCTGCGGTGCCAGGCACGG - Intronic
1162741373 19:12775588-12775610 CTGGGCTTGGGGGCGGGGCGGGG - Intronic
1162745130 19:12793722-12793744 CAGGGCCGCGGCGCCGGGAAGGG + Intronic
1162861057 19:13506130-13506152 GTGGGCAGCGGAGGCGGGCGAGG - Exonic
1163091482 19:15023075-15023097 CTGCGCGGCGGCGGCGTGCGCGG - Exonic
1163343771 19:16727059-16727081 CTGGGCTGTGGGGCTGGGCATGG + Intronic
1163621195 19:18361427-18361449 TTGGGCTGGGTGGCCGGGCGCGG - Intronic
1163672352 19:18636649-18636671 CTGGGCTGAGGAGTGGGGCGGGG - Intergenic
1164498769 19:28793925-28793947 CTGGGCCGCAGCCCCGCGCGTGG - Intergenic
1164624094 19:29715201-29715223 CGGGGCTGGGGAGCTGGGCGGGG - Intronic
1164977022 19:32581122-32581144 CCTGGCAGCGGCGCGGGGCGTGG + Exonic
1165433406 19:35784642-35784664 CTGGGGTCCGGGGCAGGGCGGGG - Intronic
1165729447 19:38135372-38135394 CTGGGCTGTGGCTCCGGGCAGGG - Intronic
1165784478 19:38453076-38453098 CGGGGCCACGGCGCTGGGCGGGG + Intronic
1165851459 19:38852231-38852253 CTGGCGGGCGGCGCCGCGCGCGG - Intronic
1166303814 19:41926692-41926714 CTGGGCCGCGGCGGCCGGCCGGG + Intronic
1166317488 19:41997295-41997317 CTGGGCGGCGGCCCGGGGCTTGG - Intronic
1166694774 19:44846339-44846361 CGGGGGTGCCGAGCCGGGCGGGG + Intronic
1166798995 19:45444360-45444382 CTGGGAACCCGCGCCGGGCGTGG - Intronic
1166852887 19:45768814-45768836 CTTGCCTGCGGAGCCGAGCGCGG - Exonic
1166887984 19:45973238-45973260 AAGGGCTGCGGCTCGGGGCGGGG - Intronic
1167268257 19:48493897-48493919 GGAGGCGGCGGCGCCGGGCGCGG - Exonic
1167311248 19:48739134-48739156 CCGGCCCGCGGCGGCGGGCGTGG - Exonic
1167465970 19:49651347-49651369 GTGGGCTGCGCGTCCGGGCGGGG - Exonic
1167551319 19:50162923-50162945 TTGGGCAGCGGGGCTGGGCGAGG - Intronic
1167633489 19:50639817-50639839 CGGGGCTGCGGCGGCGGCGGCGG - Intronic
1168045003 19:53788189-53788211 CTGTGCGCCTGCGCCGGGCGCGG + Intergenic
1168081238 19:54012067-54012089 CTGGGCTGCGGCGTGGGGGCCGG + Exonic
1168100396 19:54138254-54138276 CGGGGAGGCGGCGGCGGGCGGGG - Intronic
1168309015 19:55451537-55451559 CTGGGCGGGGGCGCCGGGACCGG - Intergenic
1168339081 19:55613634-55613656 GCGGGCAGCGGCGCCGGGGGTGG + Exonic
1168344562 19:55643935-55643957 GAGGGCTGCGGCCCCGGGGGTGG + Intronic
1168459031 19:56538759-56538781 CTAGGCTGAGGGGCGGGGCGGGG + Intergenic
924962472 2:46621-46643 CAGGGCCGGGGCACCGGGCGGGG - Intronic
925730734 2:6917970-6917992 CTGCGCTGCGGCGCGGGACAGGG + Intronic
925909714 2:8565818-8565840 CTGGGCAGTGGCTCCAGGCGAGG + Intergenic
925918253 2:8622700-8622722 CTGGGCTGTGGCGCAGGGCTGGG - Intergenic
926090100 2:10043900-10043922 GCGGGCTCCGGAGCCGGGCGGGG + Intronic
927053734 2:19352093-19352115 CGGGGTCGCGGCCCCGGGCGGGG + Exonic
927516112 2:23672534-23672556 CAGGGCTGAGGGGCCGGGAGTGG - Intronic
927956065 2:27208159-27208181 CTGGGCTGTGGCGCCAGGCTGGG - Intronic
928149257 2:28811150-28811172 CTGGGCTGAGGGACCTGGCGAGG + Intronic
931253399 2:60551871-60551893 CGGGGCTGCCGCGCCGCGCTCGG + Intronic
931515292 2:63047681-63047703 GTGGACTCCGGCGCCTGGCGGGG + Intergenic
931587287 2:63841735-63841757 CTGGACGGCGGCGCGGGGAGGGG + Exonic
932365927 2:71153620-71153642 CTGGGCTGCGGGGCCAGGAAGGG - Intergenic
932699948 2:73985311-73985333 CTGTGCGGCTGAGCCGGGCGGGG + Intergenic
932700015 2:73985504-73985526 CTGCGCTCCGGCGGCGGGCGCGG + Intergenic
933908136 2:86914492-86914514 CCGGGCTGCGGCGGCGGCGGCGG + Intronic
934045441 2:88169862-88169884 ATGGGCCGCGGGGCTGGGCGCGG + Intergenic
934653871 2:96107461-96107483 CTGGGCAGCTGCTCCGGGCCAGG + Intergenic
934993152 2:98935761-98935783 CAGGGCTTCGGCGGCGGGGGTGG + Intronic
936512159 2:113157334-113157356 GCGGGCGGCGGCGCAGGGCGGGG - Intronic
937208589 2:120252895-120252917 CTGGGGTCCGGCCCCGGGAGGGG + Exonic
937915016 2:127094757-127094779 GTGGGCTGCAGGGCTGGGCGGGG - Intronic
938397760 2:130963622-130963644 AGCGGCTGCGGCGGCGGGCGCGG - Intronic
938407362 2:131039942-131039964 CGCCGCTGCGGCGCAGGGCGCGG + Intronic
939629747 2:144517123-144517145 CCGGGCTCCGGCGCCGGCCGCGG + Intronic
941808630 2:169734167-169734189 GCGGGCAGCGGGGCCGGGCGCGG + Intronic
947353641 2:229271343-229271365 CCGGGCGGCGGCGGCGGGGGAGG - Intergenic
947741667 2:232487596-232487618 CTCGGCTGCGGCTCCGGCTGCGG - Intronic
948152441 2:235755019-235755041 CTGGGCAGCTGAGCCGGACGTGG + Intronic
948216543 2:236237343-236237365 CGGGGCCGGGGCGCGGGGCGGGG + Intronic
948216558 2:236237368-236237390 CGGGGCCGGGGCGCGGGGCGGGG + Intronic
948216573 2:236237393-236237415 CGGGGCCGGGGCGCGGGGCGGGG + Intronic
948216586 2:236237418-236237440 CGGGGCCGGGGCGCGGGGCGAGG + Intronic
948487240 2:238288712-238288734 GTGGGCGGCGGCGGCGGGCGCGG - Intronic
948824630 2:240568365-240568387 CGGGGCCGGGGCGCCGGGCGGGG - Intronic
949000444 2:241610149-241610171 CAGGGCCGCGGCGCCGGGCATGG + Intronic
1169245708 20:4022814-4022836 CTGGGCTGGGGCACCAGGCGTGG + Intergenic
1170889803 20:20367865-20367887 CGGGGCGGCGGCGCCGGGCGGGG + Intergenic
1171249444 20:23637383-23637405 CTGATCTTAGGCGCCGGGCGCGG + Intronic
1172066981 20:32228292-32228314 CTGGGCTGGGGCTCCTGGCAGGG - Exonic
1172655264 20:36532992-36533014 CTGTGCTGCTGCTCCAGGCGGGG + Intergenic
1173548073 20:43914615-43914637 CAGGGATGCAGGGCCGGGCGGGG + Intergenic
1174528628 20:51193385-51193407 CAGGGGTGCGGTGACGGGCGAGG - Intergenic
1175873678 20:62219895-62219917 CGAGGCGGCGGCGGCGGGCGGGG - Exonic
1175997159 20:62817029-62817051 CTGAGCTGCGGCGTCGGGGCGGG - Intronic
1176086426 20:63297440-63297462 CTGGGCTGAGTCCCCGGGCTGGG - Intronic
1176178684 20:63739923-63739945 CCGGCCGGCGGCGCGGGGCGGGG - Exonic
1176184489 20:63770957-63770979 CGTGGCTGCTGTGCCGGGCGTGG - Intronic
1176184504 20:63771034-63771056 CGTGGCTGCTGTGCCGGGCGTGG - Intronic
1176194398 20:63830834-63830856 CAGGCCGGCGGCGCGGGGCGGGG - Intronic
1178103973 21:29298759-29298781 CGGGGCTTCGGCGCCGGGGGCGG + Intronic
1178485906 21:33020164-33020186 CGGGACTGCGGGACCGGGCGCGG - Intergenic
1178513062 21:33223205-33223227 CTAGGCTGTGAGGCCGGGCGCGG - Intergenic
1179185507 21:39082786-39082808 CTGGGCTGCCGCTCCAGGTGCGG + Intergenic
1179243835 21:39613076-39613098 CGGGGCTGGGGCGCGGGGCGCGG + Intronic
1180660046 22:17459301-17459323 CTGGGATGCAGGGCCGGGCAGGG - Intronic
1180699729 22:17774578-17774600 CGGGGCTGTGGAGCGGGGCGGGG + Intronic
1180779270 22:18511011-18511033 CTGGGATGTGGCCCCGGGCTGGG + Intergenic
1180788074 22:18558014-18558036 CAGGGCTGTGGCGGTGGGCGAGG - Intergenic
1181233664 22:21437304-21437326 CAGGGCTGTGGCGGTGGGCGAGG + Intronic
1181244986 22:21497539-21497561 CAGGGCTGTGGCGGTGGGCGAGG - Intergenic
1181510774 22:23387906-23387928 CCGGGCTGCAGCGCAGGGCAGGG - Intergenic
1182287145 22:29255199-29255221 CTGGGCTGGGGAGCCAAGCGGGG - Intronic
1183258090 22:36776002-36776024 CTGTGCTGAGGGGCTGGGCGGGG - Exonic
1183307403 22:37089883-37089905 CTGGGCAGGGGAGCCGGGTGGGG + Intronic
1183524999 22:38317491-38317513 CGGGGCGGCGGCGGCGGGCCGGG - Intronic
1183606941 22:38871628-38871650 CTCGGCTGGGGCGCCGCGCGGGG - Intronic
1183702364 22:39457640-39457662 GTGGGCCGCGGAGCCGGGCGGGG - Intronic
1184680772 22:46071277-46071299 CGGGGCTGCGGGGCGAGGCGCGG + Intronic
1185027535 22:48424398-48424420 ATGGGCAGCAGCTCCGGGCGGGG - Intergenic
1185388294 22:50546564-50546586 CCCTGCTGCAGCGCCGGGCGGGG + Intergenic
949981163 3:9502409-9502431 GTGGGCAGAGGGGCCGGGCGCGG + Intronic
950043325 3:9933796-9933818 CTGGACTGCGGCGCGGGTGGGGG + Intergenic
950489708 3:13296451-13296473 CTGGTATGTGGGGCCGGGCGCGG - Intergenic
950710572 3:14810630-14810652 CCGGGCGGGGGCGCGGGGCGGGG - Intergenic
950710581 3:14810643-14810665 CGGGGCGGGGCCGCCGGGCGGGG - Intergenic
952652156 3:35739422-35739444 CTGGGCTGCTGGGCCGGCTGTGG - Exonic
953146183 3:40277345-40277367 ATGGGCTGCGGGGCTGGGGGAGG + Intergenic
954298946 3:49689118-49689140 CTGGGCTCTGCCGCCGGGTGTGG - Intronic
954560076 3:51549282-51549304 CTGGGCTGCTAGGCCGGGAGTGG - Intronic
956028417 3:65008991-65009013 CTGGGTTGGGGCACCGGGTGTGG + Intergenic
956080131 3:65549053-65549075 CTTGGCTGCGGCGCCAGGGCAGG - Intronic
959086557 3:101856338-101856360 CTGGGCTTCTTGGCCGGGCGCGG - Intronic
960096753 3:113696669-113696691 CTGAGCTGCGGCCGCGGGAGGGG - Intergenic
961648288 3:128404441-128404463 CTGGGCTGGGGAGACAGGCGTGG - Intronic
962793884 3:138834626-138834648 CTGGGTCGCGGCGCCGGCTGCGG - Intronic
963602804 3:147392263-147392285 CCGGGCTGCGGAGCCAGGCCTGG - Intronic
964041785 3:152269345-152269367 CTGGGCTGCCAAGCCGTGCGCGG - Intronic
966181869 3:177196486-177196508 CGGGGCGGGGGCGCCGGCCGGGG - Intronic
966919805 3:184604167-184604189 CTGGGAGGCGACGCGGGGCGGGG - Intronic
967272615 3:187743740-187743762 CTGAGCTCCGGGGGCGGGCGGGG - Intronic
967685046 3:192408980-192409002 CTGGGTAGGGGCGCGGGGCGGGG + Exonic
967904006 3:194486523-194486545 GTGGGCAGCGGCGCCGGGGGAGG - Intronic
968133649 3:196207537-196207559 CTGGGGGGCGGGGCCAGGCGTGG - Intronic
968309454 3:197671301-197671323 GTGGGATGAGGAGCCGGGCGCGG - Intergenic
968462118 4:731400-731422 CTGGGCTGAGGCCCCAGGCTCGG - Intronic
968541844 4:1171991-1172013 CTGGCCGGCGGCGCCGAGAGTGG + Exonic
968552966 4:1233480-1233502 GTGGGCTGCGGGGCCTGGAGCGG - Intronic
968556669 4:1249238-1249260 CGCGGCTGCGGGGCGGGGCGGGG + Intronic
968583699 4:1406338-1406360 CTGGGCAGCGGCGGCGGGAGCGG + Intergenic
968647357 4:1747418-1747440 CAGGGCTGCGAGGCCGGGCGGGG + Intergenic
968817278 4:2828634-2828656 CTGGGCTGCAGCTCAGGGCTGGG - Intronic
968942908 4:3648416-3648438 CTGAGCTGCGGAGGCGGGCGGGG - Intergenic
968975745 4:3821282-3821304 CTGGGCAGAGGCACCGGGCGTGG + Intergenic
969115007 4:4865967-4865989 CCGGGCTGCGGCGCAGGGAGGGG - Intergenic
969689861 4:8698494-8698516 CTGGGCTGAGGCGCATGTCGGGG + Intergenic
972632881 4:40857194-40857216 ATGGGCGGCCGCGGCGGGCGGGG - Intronic
973636012 4:52862482-52862504 CTCGGCTGCGGCGCACCGCGCGG - Exonic
973758961 4:54100144-54100166 CCGAGCCGGGGCGCCGGGCGGGG + Exonic
974009300 4:56592691-56592713 CTGGGCCGCGGGGTCGGGGGCGG + Intronic
975986257 4:80203235-80203257 CGCGGCTGCGGCGGCGGCCGCGG + Exonic
976068334 4:81215029-81215051 CTGGGCTCCGGCGCCGCAGGCGG - Exonic
978126958 4:105146596-105146618 CAGGGCGGCGGCGCAGGCCGGGG + Exonic
983923452 4:173371302-173371324 CGGGGCTGAGGTGCCGGGCGCGG + Exonic
984462906 4:180058788-180058810 CCGGTCTGCGGGGCCGGCCGCGG - Intergenic
984973572 4:185210383-185210405 CTGGGCTGCGGGCCCGGCCGTGG + Intronic
985432435 4:189894013-189894035 CAGGCCTGCAGCGCGGGGCGGGG + Intergenic
985549129 5:524374-524396 CTGGGCTGGGCCGACGCGCGGGG + Intergenic
985696661 5:1344849-1344871 CGGGCCGGGGGCGCCGGGCGCGG - Exonic
985783326 5:1881973-1881995 CTGGGCCGAGGCGGCGGGCCCGG + Exonic
985791780 5:1931854-1931876 CTGGGCTGCGCAGCCGGCGGTGG + Intergenic
986315345 5:6583174-6583196 CTGGGCTGAGGAGCCGCGGGAGG + Intergenic
987012912 5:13785358-13785380 CTGGTCTGCGGCCCCGGGGCTGG + Intronic
987374029 5:17217875-17217897 GGGGGCTGCGGGGCGGGGCGCGG - Intronic
990003811 5:50922851-50922873 GTGGGCTGCGGCTCCGGGGCCGG - Intergenic
992431690 5:76716373-76716395 CTGGCCTGCGGGCCCGGGTGCGG - Exonic
992562589 5:77967175-77967197 CTGGGCTTCTTAGCCGGGCGCGG + Intergenic
992627535 5:78648830-78648852 CTGGGCAGCGGCGCGGGGCCGGG - Intronic
994935275 5:106246337-106246359 CTGGCCTGCCGCTCCGAGCGTGG - Intergenic
995199346 5:109409686-109409708 CTGGCCTGCTGCGCCGGCCATGG - Intronic
997980211 5:138464179-138464201 CCCGGATGCGGCGCTGGGCGCGG - Intergenic
997980532 5:138465270-138465292 CTGGGATGCGGGCGCGGGCGCGG + Intergenic
1001530002 5:172454708-172454730 CTGAGCCGCCGCGCCGGGGGAGG + Intergenic
1002093537 5:176818013-176818035 CTCGGCTGCCGCCCCGGGAGCGG + Intronic
1002170316 5:177371040-177371062 CCGGGCCGCGGGGCGGGGCGGGG + Intronic
1002186276 5:177456192-177456214 CTGGACTGCGGGGAGGGGCGGGG + Exonic
1002524165 5:179806427-179806449 CTGGGCGTCGGCGGCGGGAGCGG - Intronic
1002888073 6:1312983-1313005 CGGGGCGGCGGGGCCAGGCGCGG + Exonic
1003874868 6:10426287-10426309 TTGGGCTGCGGCGGGAGGCGGGG + Intergenic
1004140639 6:13014158-13014180 CGGGGCGGCGGCGGCGAGCGCGG + Intronic
1005987605 6:30884332-30884354 CTGGAGCTCGGCGCCGGGCGTGG + Intronic
1006097592 6:31665704-31665726 CTGGGCAGCAGCGCCGCGCCGGG + Intronic
1006256868 6:32838822-32838844 CTGGGCTGGGCCGCCGGGAGGGG + Exonic
1006391647 6:33762174-33762196 CTGGGCTGGGGCCACGGGAGAGG - Intergenic
1006665221 6:35688672-35688694 CTGGGCTGCGAAGCCGCGTGGGG + Intronic
1006671431 6:35731932-35731954 CTAGGTGCCGGCGCCGGGCGCGG + Intergenic
1006860671 6:37170036-37170058 CAGGGCTGCCGGGCCGGCCGAGG - Intergenic
1007075851 6:39065674-39065696 CTGGGCTGAGGCTCAGGGCCAGG + Intronic
1007927716 6:45663482-45663504 CAGTGCTGGGGCGCGGGGCGCGG - Intronic
1010703299 6:79077760-79077782 CGGGGCCGCGGCCCGGGGCGCGG - Intronic
1011765139 6:90611472-90611494 CAGGGCTTAGGCGCCGGGCGGGG + Intergenic
1013793625 6:113860219-113860241 GCAGGCAGCGGCGCCGGGCGAGG + Exonic
1014137730 6:117907900-117907922 GTGAGCGGCGGCGCCGGGCGAGG + Intronic
1015289757 6:131525260-131525282 CTGGGCTTCTGCGTCGGGTGGGG - Intergenic
1016949378 6:149565827-149565849 CTGGGCTGCGGCTCGGGCCCTGG - Intergenic
1017163843 6:151390510-151390532 CGGGGCTGTTGCGCCGGCCGGGG - Intronic
1017793638 6:157823070-157823092 CGGGGCGGCGGCGCGGCGCGGGG + Intronic
1018094621 6:160374414-160374436 CTGGTCTGCAGCTCCCGGCGAGG - Intronic
1018150282 6:160931175-160931197 CGGGGCTGGGGCCCGGGGCGGGG + Intergenic
1018613057 6:165662159-165662181 CGGGGCGGCGGCGGCGGCCGGGG + Intronic
1018945631 6:168345677-168345699 CTCGGCTGCCCCGCCGGCCGGGG - Intergenic
1019593245 7:1846231-1846253 CAGGACTGCAGCGCCGGGGGCGG - Intronic
1019828115 7:3300893-3300915 CACCGCTGCGGGGCCGGGCGAGG + Intergenic
1020383066 7:7567001-7567023 CCGGGCTCCTGCGGCGGGCGGGG + Exonic
1020418019 7:7968754-7968776 CTGGGAGGCGGTGCCGGGGGCGG + Intronic
1020445494 7:8262530-8262552 CTGGGCGGCGGATCCGAGCGGGG - Intronic
1020727269 7:11831790-11831812 CAGGGCTGCGGCGCAGGGCGAGG - Exonic
1021963574 7:25895624-25895646 CAGTGCGGGGGCGCCGGGCGTGG - Intergenic
1022099493 7:27160837-27160859 CGGGGCTGCAGCTCCAGGCGCGG - Intergenic
1022106252 7:27199828-27199850 CGCGGCTGCGGCGGCGGCCGCGG - Exonic
1022528330 7:31052375-31052397 CTGGACTGCCGCGCCGCGCGGGG + Intergenic
1023264648 7:38392673-38392695 CTGGCCTGCGGGGCTGGGCGTGG - Intronic
1023381156 7:39609809-39609831 CTGGGGCCCGGAGCCGGGCGGGG - Intronic
1023417933 7:39950015-39950037 CTGGGCAGCGGGGCGGGGCGAGG - Exonic
1023863584 7:44228673-44228695 CCAGGCTGCGGCGCCGGGGCAGG + Intronic
1023881984 7:44325855-44325877 GTGGGGTGCGGGGGCGGGCGGGG - Intronic
1023983572 7:45082813-45082835 CTGGGCTCAGGAGCCGGGCCTGG + Exonic
1024965378 7:55019119-55019141 CTGGGCGGCGGCGGCCGCCGGGG - Exonic
1025106520 7:56175368-56175390 GTGGGTTGCGGCGCCGAGCCCGG + Intergenic
1026137917 7:67679723-67679745 CTGGGCTTGAGGGCCGGGCGCGG - Intergenic
1026623276 7:71970137-71970159 ATGGGTTGCTGGGCCGGGCGTGG - Intronic
1026765136 7:73155353-73155375 CGGGGACGCGGCGCCGGCCGGGG + Intergenic
1026851548 7:73726925-73726947 GTGGGCTGCGGGGCTGGGCATGG - Intergenic
1026930413 7:74220343-74220365 GGGGGCTGCGGGGCCAGGCGAGG + Intronic
1026968289 7:74453924-74453946 GCGGGCTGCGGCGGAGGGCGGGG - Intronic
1027041609 7:74965108-74965130 CGGGGACGCGGCGCCGGCCGGGG + Intronic
1027082033 7:75237261-75237283 CGGGGACGCGGCGCCGGCCGGGG - Intergenic
1029423532 7:100483764-100483786 TGGGGCTGGGGCGCGGGGCGGGG - Intergenic
1029701397 7:102248827-102248849 CTGGGCGGCGGCGCGGAGCTCGG - Exonic
1030080616 7:105774640-105774662 GAAGGCTGCGGGGCCGGGCGCGG - Intronic
1033656916 7:143381085-143381107 CCGGGCTGGGGCGGCGGGGGCGG + Exonic
1034446216 7:151115488-151115510 CCGGGCTCCGGCGCTGCGCGCGG - Intronic
1034489608 7:151386307-151386329 CTGGGCTGTGGCCCGGGTCGTGG - Intronic
1034500617 7:151448400-151448422 CCAGGCTGCAGCGCCGGCCGAGG + Intergenic
1034668494 7:152839251-152839273 ATGGGCTGCGGGGCGGGGGGTGG + Intronic
1034957727 7:155344943-155344965 CTGCCCTGCGGCGTGGGGCGCGG - Intergenic
1035390504 7:158501278-158501300 CTTGGCTGTAGCCCCGGGCGGGG - Intronic
1035637344 8:1156584-1156606 CTAGGCTGGGGCGCTGGGCTGGG - Intergenic
1035637352 8:1156610-1156632 CTGGGCTGGGGCGCTGGGCTGGG - Intergenic
1035637363 8:1156636-1156658 CTGGGCTGGGGCGCTGAGCCGGG - Intergenic
1036910928 8:12755894-12755916 CTGGGCGGGGGCGTCGGGGGAGG - Intronic
1037803667 8:22048316-22048338 CTGGGCTGGGGTGGCGGGAGGGG + Exonic
1037876555 8:22551634-22551656 CGGGGAGGCGGCGCCGGGAGGGG - Intronic
1038004206 8:23416315-23416337 CTGGGCTGCAGCCCGGAGCGTGG - Intronic
1038761200 8:30385037-30385059 CTGGGGCGCGGGGCTGGGCGAGG - Exonic
1038761201 8:30385042-30385064 CAGGGCTGGGGCGCGGGGCTGGG - Exonic
1039936481 8:42051337-42051359 CGGGGCTGAGGCGGCGAGCGGGG - Intronic
1040543591 8:48380382-48380404 CGGGGCTGCGGGGCCTTGCGGGG + Intergenic
1041021660 8:53644131-53644153 CAGGGCTGCGGGGCCAGGTGAGG - Intergenic
1041166921 8:55101172-55101194 CCTGGCGGCGGCGCGGGGCGCGG - Intergenic
1041910704 8:63085914-63085936 CGGCGCTGCGGCGCCGGGCCCGG - Exonic
1042040222 8:64581388-64581410 CTGGGCGGCGGCGGCGGCGGGGG + Exonic
1043463719 8:80486060-80486082 CTGGGCTGCGCCTCCGGCCTGGG - Intronic
1043847284 8:85177523-85177545 CCGAGCTGCGGCGGCGGGGGCGG - Exonic
1044699166 8:94950145-94950167 CTAGGCTGCAGCGCCTGGGGAGG - Intronic
1044819281 8:96145009-96145031 CGAGGCTGCGGGCCCGGGCGCGG - Exonic
1045277482 8:100721319-100721341 TCGGGCGGCGGCGGCGGGCGGGG - Intronic
1049237323 8:141518771-141518793 CTGGGCGGCTGGGCCCGGCGGGG + Intergenic
1049383223 8:142327841-142327863 CTGGGCTGCTGCTCCGCGTGAGG - Intronic
1049407932 8:142460045-142460067 CTGGGCTGCAGTGCCCGGCTCGG + Intronic
1049646820 8:143739300-143739322 CTGGGATGGGGCCCTGGGCGTGG - Intergenic
1049710490 8:144060885-144060907 CGGGTCTCCGGCGCCGGGCCTGG + Intronic
1049719655 8:144109886-144109908 CAAGGCTGCGGCGCAGGGGGCGG - Exonic
1049762202 8:144336657-144336679 GGGGGCGGCGGCGCCGGGCCCGG + Intergenic
1049784658 8:144444575-144444597 CTCGACGGCGGCGGCGGGCGCGG + Intergenic
1049801128 8:144517966-144517988 GGGCGCCGCGGCGCCGGGCGGGG + Intergenic
1050537782 9:6645444-6645466 CTGGGCCGCGGGGTCGGGGGCGG - Exonic
1051206373 9:14693312-14693334 CTGGGCGGCGGCGCCGGAGGAGG - Exonic
1052825022 9:33167828-33167850 ACGGGCTTCGACGCCGGGCGAGG + Intergenic
1053214165 9:36257511-36257533 CTGGGGGGAGGGGCCGGGCGCGG + Intronic
1055090864 9:72364382-72364404 CTCCGCGGCGGCGCCCGGCGTGG - Intronic
1056402652 9:86242967-86242989 GTGGCCTGCGGGGCTGGGCGTGG - Intronic
1056475127 9:86946034-86946056 CTGTGCTTCGGCGCCGAGCTGGG - Exonic
1056922285 9:90801646-90801668 ATCGGCTGAAGCGCCGGGCGAGG - Intergenic
1057045960 9:91886496-91886518 AGGGGCTGCCGCGCCGTGCGTGG - Intronic
1057313471 9:93955293-93955315 CCGGGCGGAGGCGCAGGGCGCGG + Exonic
1057313510 9:93955417-93955439 GGGGGCGGCGGCGCGGGGCGGGG - Intergenic
1057605458 9:96495397-96495419 CTGGGCAGGGGCGGGGGGCGGGG - Intronic
1057819746 9:98321890-98321912 CTGGGCTGTGGCCCTGGGCAGGG - Intronic
1058687223 9:107489564-107489586 CTGGTCGGCGGCGCAAGGCGCGG + Exonic
1059107769 9:111526002-111526024 ATGAGCTGCGGGGCCAGGCGTGG - Intronic
1059739475 9:117135708-117135730 CTGGGCTGCGGCTGCGGTAGGGG + Intronic
1060821755 9:126665305-126665327 CAGGGCTGGGGCGGCGGGGGCGG + Intronic
1060829772 9:126706145-126706167 CTGGGCTGGGGCTGCGGGTGAGG - Intergenic
1061445405 9:130634538-130634560 CAGGGCTGCGGAGCCGTGTGTGG + Intronic
1061453550 9:130681757-130681779 CTCCGCGGCGGCGCCGGGCCGGG - Exonic
1061480521 9:130895740-130895762 CTGGGCTCCGGGGCTGGGCTGGG + Intergenic
1061580122 9:131531221-131531243 CTGGGCGGGCGCGCCGGGCCTGG - Intronic
1061610030 9:131739997-131740019 CGGAGCGGCGGCGGCGGGCGCGG - Intronic
1061727483 9:132589633-132589655 CTGGGCTGGGGCGCCAGGGAGGG - Exonic
1061987274 9:134136729-134136751 CAGGTCTGCGGCCCCGCGCGAGG - Intronic
1062022559 9:134326355-134326377 CGGCGCTGCGGCGCCGGCGGGGG - Intronic
1062277210 9:135736691-135736713 GGGGGCTGCGGCGCCGGCTGGGG - Intronic
1062341355 9:136095136-136095158 CCGGGTTACGCCGCCGGGCGGGG - Intronic
1062349825 9:136133240-136133262 CGGGGTTGCGGGGCGGGGCGGGG - Intergenic
1062349851 9:136133308-136133330 CGCGGCTGCGGGGCGGGGCGGGG - Intergenic
1062364731 9:136203220-136203242 CGGGGCCGCGGGGCGGGGCGGGG + Intronic
1062414275 9:136439861-136439883 CGGGGCCGGGGCGCGGGGCGGGG - Intergenic
1062529161 9:136992392-136992414 CGGGGCTTGGGCGCCGGGAGGGG - Intergenic
1062537713 9:137028191-137028213 GCGGGCTGCGGGGCCCGGCGGGG - Intronic
1062565120 9:137160912-137160934 GTGGCCGGCGGCGCAGGGCGGGG + Intronic
1062574665 9:137200593-137200615 CTGGGCGGGGGCGCGGGGCCCGG - Exonic
1062718547 9:138023204-138023226 CTGGGCCGCGACGGCGCGCGGGG + Exonic
1185433003 X:20042-20064 CTGCGCGGCGGGGCGGGGCGGGG + Intergenic
1185747626 X:2584666-2584688 AGGGGCTGCGGCACTGGGCGGGG + Intergenic
1187363689 X:18649972-18649994 CGGGGCGGCGGCGGCGGGTGGGG - Intronic
1190320287 X:49176020-49176042 GTGGCCTGCGGCGCTGGGCCGGG + Exonic
1194666823 X:96685070-96685092 CGGGGCGGCGGCGTCGGGAGCGG + Exonic
1195728047 X:107937200-107937222 CAGGGCCGGGGCGCGGGGCGGGG - Intergenic
1195954794 X:110317830-110317852 CAGGGCTGCGGCGGCGGCGGCGG - Exonic
1196031075 X:111096312-111096334 CGGGGCTGCGGCTGCGGCCGCGG + Intronic
1197129939 X:122993821-122993843 CTGGGCTGGGTGGCTGGGCGTGG + Intergenic
1200239569 X:154486632-154486654 CGGGGCGGCGGCGCGCGGCGGGG - Exonic