ID: 1126163513

View in Genome Browser
Species Human (GRCh38)
Location 15:45634922-45634944
Sequence CTGCGGCGCCGGGCGGGGCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 560}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163501_1126163513 8 Left 1126163501 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1126163513 15:45634922-45634944 CTGCGGCGCCGGGCGGGGCACGG 0: 1
1: 0
2: 4
3: 67
4: 560
1126163496_1126163513 27 Left 1126163496 15:45634872-45634894 CCCCGTGAGCGCTCAACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1126163513 15:45634922-45634944 CTGCGGCGCCGGGCGGGGCACGG 0: 1
1: 0
2: 4
3: 67
4: 560
1126163506_1126163513 -9 Left 1126163506 15:45634908-45634930 CCATGGTGCCTGGGCTGCGGCGC 0: 1
1: 0
2: 2
3: 19
4: 253
Right 1126163513 15:45634922-45634944 CTGCGGCGCCGGGCGGGGCACGG 0: 1
1: 0
2: 4
3: 67
4: 560
1126163497_1126163513 26 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163513 15:45634922-45634944 CTGCGGCGCCGGGCGGGGCACGG 0: 1
1: 0
2: 4
3: 67
4: 560
1126163500_1126163513 9 Left 1126163500 15:45634890-45634912 CCCTGGTGTGTTCACTGACCATG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1126163513 15:45634922-45634944 CTGCGGCGCCGGGCGGGGCACGG 0: 1
1: 0
2: 4
3: 67
4: 560
1126163499_1126163513 25 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163513 15:45634922-45634944 CTGCGGCGCCGGGCGGGGCACGG 0: 1
1: 0
2: 4
3: 67
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163513 Original CRISPR CTGCGGCGCCGGGCGGGGCA CGG Exonic
900072068 1:778924-778946 CTTCGGCGCCGGGCGCAGCAAGG + Intergenic
900116943 1:1033046-1033068 CTGCGGCCCGGGGCGGGGAATGG - Intronic
900162843 1:1232477-1232499 CTGCGGCGCTCGGCGGCGCGGGG - Exonic
900360166 1:2284526-2284548 CTGAGGTGCCTGGGGGGGCAGGG + Intronic
900383978 1:2401032-2401054 CTGCTGTGCTGGGCTGGGCACGG + Intronic
900538449 1:3190705-3190727 CGGCGGCGACCGGCGGGGCGTGG - Intronic
900677907 1:3900128-3900150 CAGCTGCGCCGGGCAGGGCGGGG - Intronic
901050721 1:6424706-6424728 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
901242826 1:7704810-7704832 GGGCGGGGCCGGGCGGGGCGCGG + Intronic
901373070 1:8817252-8817274 CTGCGGGGCCGCGGGGCGCAGGG + Exonic
901443372 1:9292803-9292825 GGGCGGGGCGGGGCGGGGCAGGG + Intergenic
901629031 1:10639256-10639278 CGGCGGCGTCGGGCGGGCCGGGG + Exonic
901833675 1:11909555-11909577 CGGCGGGGCACGGCGGGGCACGG - Intergenic
901833679 1:11909565-11909587 CGGCGGGGCACGGCGGGGCACGG - Intergenic
902691188 1:18110820-18110842 CAGTGGCGCCGGGCTGGGGATGG + Intronic
902896997 1:19485722-19485744 CTGCGAGGCGGGGCGGGGCGCGG + Intergenic
903389365 1:22953415-22953437 CGGCGGAGCCGGGCCGGGCTCGG + Exonic
903446296 1:23424640-23424662 CCGCGACGCCCGGCGGGGCGAGG + Exonic
903466390 1:23554968-23554990 GTGGGGCGCCGGGAGGGGCGGGG + Intergenic
903536243 1:24068170-24068192 GTGCGGGGCAGGGCGGGGCAGGG + Intronic
904437151 1:30506351-30506373 CAGCGGGGCCAGGCGGGGCTGGG + Intergenic
904478122 1:30777497-30777519 CTGGGGCCCAGGGCAGGGCAGGG + Intergenic
904618933 1:31764079-31764101 GGGCGGCGCCGGGCCGGGCGCGG + Intronic
904772144 1:32886453-32886475 CTGCTGCGGCGCGCGCGGCAGGG - Exonic
904775082 1:32901420-32901442 CTGCGGGGCCGGGCGGCCCGGGG - Intronic
905179212 1:36156181-36156203 GGCCGGCGCCGGGCGGGGAACGG + Exonic
905390991 1:37635108-37635130 CCGGGGCGCGGGGAGGGGCAGGG - Intergenic
905790290 1:40785822-40785844 ATGCGGCACAGGGAGGGGCAGGG + Intronic
905847111 1:41242216-41242238 CTGAGGCGGGGGGCGGGGCGGGG + Intergenic
906034148 1:42740388-42740410 CTGCGGAACGGGGCGGGGCAGGG - Intergenic
906627038 1:47333880-47333902 GCGCGGCGCGGGGCGGGGCGGGG - Exonic
907359538 1:53903354-53903376 CTGTGATGCTGGGCGGGGCATGG + Intronic
908477762 1:64505855-64505877 CGGCGGGGCGGGGCGGGGCGGGG - Intronic
910221494 1:84893251-84893273 CGGCGGGGCGGGGCGGGGCAGGG - Intergenic
910231999 1:84997171-84997193 CGGCGGGGCGGGGCGGGGCGGGG - Intergenic
912354289 1:109042228-109042250 CGGCGGGGCGGGGCGGGGCGGGG + Intergenic
912798623 1:112707227-112707249 CTGCGGCCCTGCGCGGGGCCGGG - Intronic
912800178 1:112715309-112715331 CCGCGGCCGAGGGCGGGGCAGGG - Exonic
913109045 1:115641828-115641850 CTGCAGCGGAGGGCGGGGCTCGG - Intergenic
915559180 1:156676615-156676637 CGGCTGGGCCGGGCGGTGCAGGG - Exonic
919822177 1:201480537-201480559 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
919920854 1:202165729-202165751 CGGGGGCGGCGGGCGGGGGAAGG - Intergenic
920264437 1:204711344-204711366 CTGCGGTGCAGGGCTGGACACGG - Intergenic
920333385 1:205228150-205228172 CTGCGGGGCGAGGCGGGGCGCGG - Intergenic
920409703 1:205749737-205749759 CAGCGGCGCGGGGCGGGGAGGGG + Intronic
920556743 1:206909702-206909724 GTGAGCCGCCGGGCGGGCCACGG - Intronic
921167141 1:212515252-212515274 GTGCGGGGCGGGGCGGGGCGGGG - Intergenic
922200065 1:223393819-223393841 CTGCCAAGCCGGGCGGGGCTTGG - Exonic
922267002 1:223992879-223992901 CTTCGGGGCCGGGCGCAGCAAGG + Intergenic
924415175 1:243850310-243850332 CGGCGGCGGCGGGAGGGGGAGGG + Intronic
924436802 1:244049230-244049252 CTGCGGGGTCGGGCGGGGTGCGG + Intronic
1062843907 10:690040-690062 CCGCGGGGCGGGGCGGGGCGGGG + Intergenic
1063623375 10:7667661-7667683 AAGCGGCGCCGGGCGGGGTGGGG - Intergenic
1063944639 10:11165039-11165061 GTGGGGCGGGGGGCGGGGCAGGG + Intronic
1065025371 10:21535066-21535088 CGGCGGGGCGGGGCGGGGCAGGG + Intronic
1066726695 10:38402715-38402737 CTTCGGGGCCGGGCGCAGCAAGG - Intergenic
1067113966 10:43420597-43420619 CTGCTGCGCGGGGCGGGACGCGG + Intergenic
1067336822 10:45373605-45373627 CTGCGGCTCCTGGCGGGGGCAGG - Intergenic
1068335723 10:55630679-55630701 CTGCGGTGCCGGGCGGGCTCAGG + Intergenic
1069833641 10:71295731-71295753 CTGTGGCACTGTGCGGGGCAGGG - Intronic
1069837604 10:71319201-71319223 CTGCCGCGAGGGGCGGGGCGGGG + Intergenic
1070162237 10:73873723-73873745 CTGGGGGGGCGGGCGGGGCGGGG + Intronic
1070780392 10:79134192-79134214 CTGGGGCTCAGGGCGGGGTAGGG + Intronic
1070895780 10:79982138-79982160 CGGGCGCGCCTGGCGGGGCAGGG + Intronic
1070912797 10:80132831-80132853 GTGGGGCGCAGGGCGCGGCAGGG + Intronic
1072027610 10:91476888-91476910 CTGCGGGTCCGGGCCGGGCGCGG + Intronic
1073076691 10:100828922-100828944 CTACGGGGCCGGGCGGGGCGGGG - Exonic
1073493657 10:103872339-103872361 CTGAGGCACTGGGCTGGGCAGGG + Intergenic
1074772365 10:116742384-116742406 CGGCCGCGGCTGGCGGGGCAGGG - Intronic
1075430397 10:122375119-122375141 CAGCGGCGCCCGGCGGGGGAGGG + Intronic
1075501732 10:122980717-122980739 CTGGGCCGCGGGGCGGGGCGGGG + Intronic
1075501736 10:122980722-122980744 CCGCGGGGCGGGGCGGGGCGGGG + Intronic
1075736502 10:124667655-124667677 CTGTGACCCCGGGCGGGGCTGGG - Intronic
1076542189 10:131221197-131221219 CTGCGGCTCTTGGCGGGTCAGGG - Intronic
1076900911 10:133336919-133336941 CTTCGCGGCCGGGCGGGGCGGGG + Intronic
1077038486 11:506957-506979 GGGCGGGGTCGGGCGGGGCAGGG - Intronic
1077048584 11:556668-556690 CTGCAACGCCTGGCGGGGCAGGG + Intronic
1077079927 11:720750-720772 AGGCGGTGCCGGGCGGGGCAGGG + Intronic
1077082388 11:729825-729847 CTGCGGGGCCTGACTGGGCACGG - Intergenic
1077185507 11:1233870-1233892 ATGCGGGGCGGGGCAGGGCAGGG - Intronic
1077303499 11:1857570-1857592 CTGGGGCGGCGGGAGGGGGATGG + Intronic
1077392940 11:2308358-2308380 CTGCGGGGCCTGGTGGGGCCTGG - Intronic
1077867419 11:6234639-6234661 GTGTGGCGCGGGGCGGGGCGCGG - Exonic
1077898826 11:6474014-6474036 CCGCGGCGGCGGGCGGGGCGTGG - Intronic
1078066234 11:8081152-8081174 CTGCGGGGCGGGGCGGGGCGGGG + Intronic
1078987115 11:16607246-16607268 TTGGGGCGCCGGAGGGGGCAGGG - Intronic
1079076723 11:17389145-17389167 CGGCGGCGGCGGGCGGGGCCGGG - Intronic
1079090479 11:17476893-17476915 CAGCGGGGCTGGGCGGGGCCCGG - Intergenic
1080045782 11:27806312-27806334 GTGCGGGGCGGGGCGGGGCGGGG - Intergenic
1082035505 11:47642338-47642360 ACGGGGCGCCGGGCGGGGTAGGG + Intronic
1082848013 11:57741752-57741774 CAGTGGCGCCGGGGGGGGCCAGG + Intronic
1083207524 11:61161489-61161511 CTGGGGCGCCGGACGTTGCAAGG - Exonic
1083336087 11:61922702-61922724 CCGCTGGGCGGGGCGGGGCAGGG - Intergenic
1083554437 11:63614467-63614489 CGGCGGCGCGGGGAGGGGCCGGG - Intronic
1083772950 11:64878535-64878557 AGGCGGGGCCGGCCGGGGCAGGG + Exonic
1083814990 11:65127741-65127763 CTGGGGGGAGGGGCGGGGCAGGG + Exonic
1083816377 11:65134570-65134592 CGGCGGCGCGGGGCGCGGCGTGG + Intergenic
1083886514 11:65575998-65576020 CTCCGGCGCGGGGCGGGGGCCGG - Intergenic
1083895180 11:65616229-65616251 CTCAGGCGCCAGACGGGGCATGG + Exonic
1083920889 11:65780976-65780998 TGGCGGCGCGGGGCGGGGCGCGG + Intergenic
1084021316 11:66419991-66420013 CGGCTGCGGCGGGCGGGGCCTGG - Intergenic
1084212445 11:67630280-67630302 CGGCGGGGCGGGGCGGGGCGGGG + Intergenic
1084399358 11:68934755-68934777 CTGGGGCACCGGGCAGGGCGGGG - Intronic
1084758320 11:71252580-71252602 CTCCCGCGCCGGGCGGGGCCGGG - Intergenic
1084973062 11:72781783-72781805 CTGGGGCCCGGGGCGGGGCCGGG - Intronic
1084973107 11:72781913-72781935 CTGCGGGGTGGGGCGGGGCGGGG - Intronic
1085050334 11:73376907-73376929 CTGCGGCGCGGGGCGGCCAAGGG + Intronic
1085312506 11:75525005-75525027 AGGCGGGGCGGGGCGGGGCAGGG + Intronic
1085390591 11:76180148-76180170 CTGCAGCACAGGGCAGGGCATGG + Intergenic
1085396528 11:76209575-76209597 CTGCGGGGCGGGGCGAGGCCGGG + Intronic
1088172969 11:107018281-107018303 CGGCGGCGCCGGGCTGGGCTGGG + Exonic
1088823484 11:113475290-113475312 CGGCGGGGCGGGGCGGGGCGGGG + Exonic
1089273364 11:117316137-117316159 CGGCGGCGCGGGCAGGGGCAAGG + Exonic
1089398800 11:118152780-118152802 CTGCGCCGCCGGTCGGGGCTCGG + Exonic
1089527538 11:119107284-119107306 CACCCGCGCCGGGCGGGGCCAGG - Exonic
1090385546 11:126355872-126355894 CCGCGGGGCGGGGCGGGGCGGGG + Intronic
1091000999 11:131910788-131910810 CGGCGGGGCTCGGCGGGGCAGGG - Intronic
1091225987 11:133956644-133956666 CGAGGGCGCCGGGAGGGGCAGGG + Intronic
1091259693 11:134224658-134224680 CGGCGGCTCCGGGCGGGGGAGGG - Exonic
1091563384 12:1630586-1630608 CCACGGTGCCGGGAGGGGCAGGG + Intronic
1091568258 12:1662967-1662989 GTGCGCTGCGGGGCGGGGCACGG - Intergenic
1092045974 12:5432144-5432166 CTGCGTCGCGGGGCGGTGCGCGG - Exonic
1092239569 12:6828630-6828652 CTGCGGAGCCAGGCGGCGCTGGG + Exonic
1092286250 12:7130625-7130647 GTGCGGCGTGGGGCAGGGCAGGG - Exonic
1093035996 12:14333057-14333079 CTGCCACGCCTGGCTGGGCATGG + Intergenic
1094470170 12:30795818-30795840 CTGCGCTGCCCAGCGGGGCACGG - Intergenic
1095949302 12:47773278-47773300 CTGCGGCGCCGGGCGGGCCGAGG - Exonic
1096460880 12:51821012-51821034 CGGCGGCGCCGGGCGCAGCCAGG + Intergenic
1096781660 12:53995571-53995593 CTGGGGCTCCGGGCAGGGCAGGG + Intronic
1102041361 12:109802968-109802990 GTGGGGCCCCGGGCTGGGCAGGG - Intronic
1102300356 12:111766892-111766914 CTGCCGCGCGGGGCGGGGAGCGG + Intronic
1102933576 12:116879826-116879848 CTGCGGCGCGCGGCGGGGCTCGG + Intronic
1103137326 12:118518871-118518893 CTGAGGCCCCGGGAGGGGAAGGG + Intergenic
1103320002 12:120086964-120086986 CCGCGGCGCAGCGCCGGGCATGG - Intronic
1103452644 12:121040108-121040130 CTGGGGATCCGGGCTGGGCATGG + Intergenic
1104020556 12:124989205-124989227 AGGCGGAGCCGGGCCGGGCAGGG + Intergenic
1104754129 12:131258377-131258399 CTGGGGAGCTGGGCGGGGTAGGG + Intergenic
1104989673 12:132618652-132618674 CTGCGGGGCGGGGCGGGGCCGGG + Intergenic
1105389233 13:19959248-19959270 CTCCGGCGGGGGGCGGGGGAGGG + Intronic
1105900442 13:24747652-24747674 CGGCGGGGCACGGCGGGGCACGG + Intergenic
1106036978 13:26051981-26052003 GTCTGGCGCCGGGCGGGGCGAGG - Intergenic
1106250489 13:27978544-27978566 GGGCGGGGCGGGGCGGGGCAGGG - Intronic
1106250495 13:27978554-27978576 CTTTGGGGCCGGGCGGGGCGGGG - Intronic
1107086560 13:36432396-36432418 GGGCCGGGCCGGGCGGGGCAGGG - Exonic
1107086576 13:36432431-36432453 GGGCGGGGCAGGGCGGGGCAGGG - Exonic
1107770869 13:43786695-43786717 GTGGGGCGCCGGGCGCGGCGCGG + Exonic
1112504751 13:99969141-99969163 CTGCGGCGCGAGGCGGTGGATGG - Intronic
1112621911 13:101061910-101061932 CTGCGGGGCAGGGCGGGGCGGGG + Intronic
1113082845 13:106535619-106535641 CCGCGGCGCCGGCCGGAGCGAGG - Intergenic
1114676252 14:24442284-24442306 GGGCGGCGCAGGGCGGGGCAGGG - Intronic
1114769110 14:25408570-25408592 CTGCAGTGGCGGGCCGGGCACGG - Intergenic
1115474506 14:33800452-33800474 CGTCGGCGCCGGGCGGGGTGAGG - Exonic
1115851757 14:37595030-37595052 GCGCGGCGCGGGGCGGGGGAGGG + Exonic
1116018356 14:39432563-39432585 CCGCGGGGCGGGGCGGGGCTGGG + Intergenic
1119003992 14:70907833-70907855 CGGCGGCGCCGGGTGGGGATGGG + Exonic
1121042142 14:90758323-90758345 CGGCGGGGCGGGGCGGGGCGGGG + Intronic
1121050492 14:90816453-90816475 CGGCGGCGGCGGGCGCGGCGGGG + Intronic
1121368026 14:93332663-93332685 CTGGGGCGCCGGGCGGGGAGGGG - Intronic
1121595245 14:95157304-95157326 CGGCGGCGCCGGGCGGCTCCGGG - Intronic
1121617063 14:95320099-95320121 GGGCGGGGCGGGGCGGGGCAGGG + Intergenic
1122038298 14:98964327-98964349 CTGCAGCACAGGGTGGGGCAGGG - Intergenic
1122145075 14:99684165-99684187 CTGGGGGGCGGGGCGGGGCGGGG + Intergenic
1122221338 14:100240389-100240411 CGGCAGCGCCGGGCGGGGGCGGG - Intronic
1122548728 14:102538894-102538916 CTGCGGGGCCGGGCATGGCCTGG - Intergenic
1122625753 14:103084572-103084594 CCCTGGCGCCGGGCAGGGCAAGG + Intergenic
1122657638 14:103273172-103273194 AGGCGGCGCAAGGCGGGGCAAGG + Intergenic
1122775910 14:104116902-104116924 CTGGGGCGCCGGATGGGGCGGGG + Intergenic
1123004469 14:105314715-105314737 GCGGGGCGCCGGGCGGGGCGGGG + Exonic
1123036901 14:105475233-105475255 GGACGGCGCCGGGCGGGGCGGGG + Intronic
1123964050 15:25438375-25438397 CGGCGGCGGGGGGCGGGGAAGGG + Intronic
1124922401 15:34039201-34039223 CAGCGGAGCGGGGCGGGGCGGGG + Intronic
1125606473 15:40942268-40942290 CTGCTGCGACGGCGGGGGCAGGG - Intergenic
1125726302 15:41870015-41870037 CTGCAGCTGCGGGAGGGGCAGGG + Exonic
1125728868 15:41881970-41881992 CTGCGGCGGCTGGAGGAGCAGGG - Exonic
1126163513 15:45634922-45634944 CTGCGGCGCCGGGCGGGGCACGG + Exonic
1128067707 15:64775139-64775161 CTGCCGCGCCTCGCGGGGCCGGG - Intronic
1128144786 15:65327062-65327084 CTGCGGTGCTGGGTGGGCCAGGG - Intergenic
1128455265 15:67828204-67828226 CTGCGGGGCCGGGCGGAGAACGG + Intronic
1128460606 15:67863866-67863888 CAGCGGCCGCGGGAGGGGCAGGG - Intergenic
1129387283 15:75202842-75202864 CGGCGCCGCCGGGAGGGGCTTGG + Intronic
1129710789 15:77819392-77819414 CCGCGGCGGCGAGCGCGGCAGGG + Intronic
1129780223 15:78264896-78264918 GTGCGGGGCGGCGCGGGGCACGG + Intronic
1129945209 15:79533760-79533782 CTGAGGAGCAGGGCGGGACATGG - Intergenic
1130002553 15:80059906-80059928 CTCGGGCGCCGGGAGGGGCCGGG - Intronic
1131060281 15:89400142-89400164 CGGCGGGGCGGGGCGGGGCGGGG - Intergenic
1131060287 15:89400152-89400174 CTGCGGGGCGCGGCGGGGCGGGG - Intergenic
1131260284 15:90884341-90884363 CTGCGGCCCAGCGCGGAGCAGGG + Intronic
1132042625 15:98537730-98537752 CTGAGCCTCCTGGCGGGGCAGGG - Intergenic
1132090709 15:98946190-98946212 AAGCGGGGCGGGGCGGGGCAGGG + Intronic
1132314380 15:100879668-100879690 CAGGGGCGGCGGGCGGGGCGGGG + Exonic
1132480649 16:164842-164864 CGGCGGGGCGGGGCGGGGCGGGG + Intronic
1132498859 16:275951-275973 GCGCGGCGCGGGGCGGGGCCGGG - Intronic
1132501266 16:285792-285814 CTGCGGGGCCTGCAGGGGCAGGG - Intronic
1132519984 16:382389-382411 CACGCGCGCCGGGCGGGGCAGGG - Intronic
1132583444 16:695380-695402 GGGCCGCGCCGGGCGGGGCTGGG - Intronic
1132694351 16:1195297-1195319 CTGGGGCTCAGGGCGGGGCAGGG + Intronic
1132741405 16:1414910-1414932 CTGCAGGGCAGGGCAGGGCAGGG - Intergenic
1132889370 16:2196429-2196451 CTGCGGCCCCGGCCGCGCCATGG - Exonic
1132934936 16:2475342-2475364 CTGCAGCGCCGGGCGGTGCCGGG - Intronic
1132947046 16:2537724-2537746 GGGCGGGGCTGGGCGGGGCAGGG - Intergenic
1132947053 16:2537739-2537761 CTGCGGGGCGGGGCTGGGCGGGG - Intergenic
1132978323 16:2721302-2721324 GGGCGGCTCCGGGCGGGGCTGGG + Intergenic
1133188523 16:4116581-4116603 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
1133304830 16:4802346-4802368 CCGCCACGCCCGGCGGGGCAGGG + Intronic
1134438879 16:14285781-14285803 CTGCTGCGGCCGGCGGGGCGGGG - Intergenic
1135382823 16:22008416-22008438 CTGGCGCGCCGGGCCGGGCGGGG + Intronic
1135984463 16:27173881-27173903 CTGCAGCAGCGGGCTGGGCAGGG - Intergenic
1136356132 16:29745744-29745766 CTGCCGGGCCGGGCCGGGCCAGG + Intronic
1136579408 16:31142689-31142711 GGGCGGCACCGGGCGGTGCAGGG - Intronic
1137300530 16:47144029-47144051 GCGCGGCGCGGGGCGGGGCGGGG - Intergenic
1138105881 16:54286943-54286965 GCGCGGGGCGGGGCGGGGCAGGG + Intergenic
1138360755 16:56425447-56425469 CCGCCGCGCCGGGCCGGGCCGGG + Exonic
1138442303 16:57042391-57042413 CTGGGGTGCCGGGAGGGGCTGGG + Intronic
1139402938 16:66696643-66696665 CGGCGGCGGCGGGCGGGCCGCGG - Exonic
1139429521 16:66903757-66903779 CTGGGGGCCTGGGCGGGGCAGGG - Intergenic
1139446234 16:67000410-67000432 CTGAGGCGCCGGGCAGGGAGGGG + Intronic
1139465239 16:67150735-67150757 CTGCGACCCAGGGCCGGGCAGGG + Intronic
1141608701 16:85169626-85169648 CGGCGGCATCGGGCGCGGCAAGG + Intergenic
1141840116 16:86568552-86568574 CTGCGGCGTCGGCTGGGGCTGGG - Exonic
1141958971 16:87392102-87392124 CAGCGGTGCTGGGCGGGGCTGGG + Exonic
1142611051 17:1109363-1109385 CTGCGGGGCCGGGCGGGACACGG - Intronic
1142757510 17:2024771-2024793 CCCCGGCGCCGGGCGGCGCCCGG + Intronic
1142762484 17:2050438-2050460 CGCGAGCGCCGGGCGGGGCAGGG - Intergenic
1142812167 17:2400513-2400535 CTGCGGAGCCTGGCAGCGCACGG - Intronic
1143565289 17:7717206-7717228 GGGCGGCGCGGGGCGGGGAAAGG - Intergenic
1143582650 17:7835745-7835767 GTGCGGCGCAGGGCGGGGGGTGG - Intergenic
1143595107 17:7909349-7909371 CGGCGGCCCCGCGCGGGGGAGGG + Intronic
1144021180 17:11241113-11241135 CTGCGGCCCCGCGCGCGGCTCGG - Intergenic
1144107303 17:11997509-11997531 GTGCGGCACCGGGCGGAGCTAGG + Intronic
1144693012 17:17281101-17281123 CTAGGCCGCCGGGCTGGGCATGG - Intronic
1144847161 17:18225876-18225898 GCGCGGCGCGGGGCGGGGCCGGG + Intronic
1144870047 17:18363627-18363649 CTGCGGCGCAGCGGCGGGCAGGG + Intergenic
1145128397 17:20320550-20320572 CTGCGGCACAGGGCGGGGAGCGG + Intergenic
1145196215 17:20896664-20896686 CTGCGGCACAGGGCGGGGAGCGG - Intergenic
1145279429 17:21457099-21457121 CTGCGGGGAGGGGCGGGGCCCGG - Intergenic
1147183672 17:38702405-38702427 CTCCGGGGACGGGCGGGGCGGGG + Intergenic
1147657367 17:42098489-42098511 GGGCGGGGCCCGGCGGGGCAGGG + Intergenic
1147752559 17:42745074-42745096 AGGAGGCGCGGGGCGGGGCACGG - Intergenic
1148603072 17:48908649-48908671 CGGCGGCAGCGGGCGGGGCCGGG + Exonic
1148830172 17:50426110-50426132 CGGCGGGGCGGGGCGGGGCGCGG - Intergenic
1150225565 17:63523015-63523037 CTACGGGGCGGGGCGGGGCGGGG - Intergenic
1150373671 17:64662382-64662404 CGGCGGGGCGGGGCGGGGCCGGG + Intergenic
1150561919 17:66302323-66302345 CGGCGGCGGCGGCCGGGGGAGGG - Intergenic
1150778716 17:68101874-68101896 CTGGGGCGGCGGGCGGGACGGGG - Intergenic
1151660674 17:75516509-75516531 CTCCGGCGGTGGGCGGGGCGTGG + Exonic
1152357715 17:79814835-79814857 CGGCGGCGGCGGGAGGGGCGCGG + Intergenic
1152400957 17:80065804-80065826 CTGCGGCGCTGGGAGGGGAGAGG + Intronic
1152433110 17:80260518-80260540 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433123 17:80260548-80260570 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433136 17:80260578-80260600 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433149 17:80260608-80260630 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433162 17:80260638-80260660 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433175 17:80260668-80260690 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433188 17:80260698-80260720 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433201 17:80260728-80260750 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433214 17:80260758-80260780 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433227 17:80260788-80260810 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433240 17:80260818-80260840 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152552094 17:81035016-81035038 CGGCAGCGCCGGGCGGGGGCGGG + Intergenic
1152666154 17:81570760-81570782 CTGTGGCCCAGGGCTGGGCATGG + Intronic
1152703874 17:81833120-81833142 CTGCAGGGCCGGGCGGGGCCGGG - Intronic
1152711206 17:81871216-81871238 CGGCGGCGCCGGCGGGGGCGGGG - Intronic
1152721929 17:81927579-81927601 CTCCGAGGCCGCGCGGGGCAGGG + Exonic
1152729191 17:81961456-81961478 CGGCGGCGCCGGGCTGGCCGCGG - Intronic
1152748471 17:82051851-82051873 CCGGGGCGCGGGGCGGGGCGGGG - Intronic
1152785343 17:82245061-82245083 CCGCGGAGCCGGGCTCGGCAGGG + Intronic
1152945433 17:83195239-83195261 CTGCGGGGCTGGGCTGGGCTGGG + Intergenic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1155199285 18:23503370-23503392 CTCCAGCGCCGGGCGGGGCGTGG + Intergenic
1155392720 18:25352303-25352325 CGGCGGCGGCGGGCGGGGCTCGG - Intergenic
1155507791 18:26549040-26549062 CGGCTGCGCCGGGCGGGCCGCGG + Exonic
1157496669 18:48161721-48161743 CTCCGGAGCGGGGCGGGGCTGGG - Intronic
1157764418 18:50286107-50286129 CTGCAGCGCCGGGCAGGGTCAGG - Exonic
1160453344 18:78979749-78979771 CGGCGGCGGCGGGGGGGGCGCGG + Intergenic
1160691270 19:461509-461531 CTGAGGCGCGGGGAGGGGAAGGG + Intergenic
1160704608 19:524199-524221 CCGGGGAGCTGGGCGGGGCAGGG - Intergenic
1160735972 19:662629-662651 CGGTGGCGCGGCGCGGGGCAGGG - Intronic
1160745439 19:709100-709122 CCGCGGTGCCGGGCGGGGGCGGG - Exonic
1160853454 19:1205756-1205778 CGGCGGCGCAGGGAGGGGGAGGG + Intronic
1160864100 19:1249593-1249615 CTGCGGGCGCGGGCGGGGCGGGG + Intronic
1160864426 19:1250691-1250713 CGGCGACCCCGGGCGGGGGAGGG - Intronic
1160913099 19:1483812-1483834 CGGCGGGGCCGGGCGGGGGCGGG - Intronic
1161175887 19:2841881-2841903 TCGCGGCCCCGGGCGGGGCGTGG - Intronic
1161220947 19:3117903-3117925 CTGCGGCGGCCGGCAGGGCTGGG - Intronic
1161304160 19:3557610-3557632 CGACTGCGCCGGGCGGGGCAGGG + Intronic
1161388013 19:4007334-4007356 CGGCGGCGTCGGGCAGGGGATGG - Intergenic
1161392706 19:4029431-4029453 CTGCGGGACCTGGCGGGTCACGG + Intronic
1161581732 19:5084853-5084875 CCGGGGCGGCGGGCGGGGGAGGG - Intronic
1161851369 19:6739631-6739653 GGGCGGGGCCGGGCGGGGCGGGG + Intronic
1162207360 19:9065783-9065805 CTGCGAGGCTGGGCGGGGCTGGG + Intergenic
1162911042 19:13847846-13847868 CTGCGCCGCCGGCAGGGGGAGGG - Intergenic
1162931775 19:13961117-13961139 CTGCGGAACGGGGCTGGGCAGGG + Exonic
1163298689 19:16429661-16429683 CTGAGGAGCAGGGTGGGGCAGGG - Intronic
1163442423 19:17328679-17328701 GAGCGGCGGCGGGCGGGGGAAGG - Exonic
1163638870 19:18450489-18450511 CTGGGGCTCCGGGGGTGGCATGG + Exonic
1163807083 19:19405931-19405953 CCGCGGGGCCGGGCGGCGGAGGG - Intronic
1165293175 19:34905392-34905414 CTGCGGGGCGTGGCGGGGCCGGG - Intergenic
1165426413 19:35748334-35748356 CGCCTGCGCCGCGCGGGGCACGG - Intronic
1165784481 19:38453081-38453103 CCACGGCGCTGGGCGGGGCAGGG + Intronic
1165832333 19:38735964-38735986 GGGCGGGGCGGGGCGGGGCAGGG + Intronic
1166375459 19:42324738-42324760 ATCCGGCGCCGCTCGGGGCAGGG - Exonic
1166731973 19:45064326-45064348 CGGCGGCTGCAGGCGGGGCACGG - Exonic
1166852846 19:45768686-45768708 CGGCGGCGGCGGCCGGGGCCGGG - Exonic
1167073044 19:47231382-47231404 CTGCAGCGGGGGACGGGGCAGGG + Intronic
1167080639 19:47274517-47274539 CTGCGGCACAGGGCGGGTTAGGG + Exonic
1167428439 19:49441476-49441498 CTGCGGGGCCGGCCGGGCCGGGG - Exonic
1167606122 19:50481962-50481984 GTGGGGCGCAGGGAGGGGCAGGG - Intronic
1167609911 19:50502033-50502055 CTGCAGAGGCTGGCGGGGCACGG - Intergenic
1167613293 19:50517546-50517568 CGGCGGGGCCGGGCGGGCGAGGG - Exonic
1168064304 19:53910282-53910304 CTGAGCCGCCAGGCGGGGGATGG + Intronic
1168100395 19:54138249-54138271 AGGCGGCGGCGGGCGGGGCCCGG - Intronic
1168293763 19:55369347-55369369 CTGGGCCCCGGGGCGGGGCATGG + Intronic
1168339459 19:55615004-55615026 CAGCGGCAGCGGGCGGGGCGTGG - Exonic
1168459034 19:56538764-56538786 CTGAGGGGCGGGGCGGGGCGGGG + Intergenic
925018754 2:552406-552428 GTGCGGCGGTGGGTGGGGCAGGG - Intergenic
925169952 2:1744267-1744289 CTGCGGCGCCACGGCGGGCACGG + Exonic
925609347 2:5691418-5691440 CAGGGACGCCGGGCGGGGCGCGG + Intergenic
927679769 2:25131912-25131934 GTGCGGCGCGGGGCCGGGCCGGG + Intronic
927679811 2:25132004-25132026 CTGAGGCGCAGGGCGGGGTGGGG + Intronic
927943254 2:27118849-27118871 CTGCGGCGCCGCGCGGCTCTGGG + Exonic
929460858 2:42101358-42101380 CTGCGGCGCCGCGCGGGCCTCGG - Intergenic
929511456 2:42568695-42568717 CGGCGGCGGCGGGCGGGGCTCGG + Intronic
931515293 2:63047686-63047708 CTCCGGCGCCTGGCGGGGTAAGG + Intergenic
931671949 2:64654658-64654680 CTTCGGGGCCGGCCGGGGCTCGG + Intronic
931681163 2:64750988-64751010 CGGCGGGGACGGGCGGGGTAAGG + Intronic
932616197 2:73233169-73233191 ACGCGGCGCCGGGCCGGGCCCGG - Exonic
932761709 2:74442176-74442198 TTGGGGCGGCTGGCGGGGCAGGG - Intronic
933690377 2:85175075-85175097 GAGCTGCGCCGGGCGGGCCAGGG - Intronic
936512156 2:113157329-113157351 CGGCGGCGCAGGGCGGGGAGGGG - Intronic
936556870 2:113503782-113503804 CTGCGGGGCGGCGCGGGGCCCGG - Intergenic
937044010 2:118841588-118841610 CTGCGGAGCCTCGCGGGGCTCGG - Intergenic
937853733 2:126657721-126657743 CTGCTGGGCTGGGCTGGGCACGG - Intronic
937993049 2:127674849-127674871 CGGCAGCGCCCGTCGGGGCAGGG - Intronic
938238141 2:129722866-129722888 CTGCTGCGCCAGGCAGGGCGGGG + Intergenic
938500511 2:131829513-131829535 CTGCGGGGCGGGGCGGGCCCAGG + Intergenic
940009436 2:149038688-149038710 CTACCGCGCGGGGCGGGGCGCGG - Exonic
940774943 2:157875877-157875899 GGGCGGCGCGGGGCGGGGCGGGG + Intergenic
942098491 2:172555981-172556003 CTGCGCCGCTGGGCGGGACGCGG - Intronic
942799736 2:179861435-179861457 CGGCGGGGCCGGGCCGGGCCGGG - Exonic
943669836 2:190648987-190649009 CGGCGGAGGCGGGCGGGGGAGGG + Intronic
946231287 2:218292514-218292536 CTCCGGGGCCGGGCAGGGCTAGG + Intronic
947399128 2:229714594-229714616 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
947623356 2:231604681-231604703 CTGCTGGGCCGGGCCGGGCTGGG - Intergenic
947623466 2:231605015-231605037 CTGCGGGCCCGGGCGGGGCGGGG + Intergenic
947992299 2:234497154-234497176 CCCCGGCGGCGGGCGGGGCGGGG - Intergenic
948600158 2:239103324-239103346 CTGTGGCCCCGGGCGGTCCAAGG - Intronic
948805760 2:240452981-240453003 CAGCGGCTCCGGGCGGCGCGCGG - Intronic
948916035 2:241035537-241035559 CTGCGGCCCCAGGCTTGGCAGGG - Intronic
949045727 2:241871943-241871965 CTGGGGTGCCGGGCTGGGCCGGG - Exonic
949048971 2:241887020-241887042 CTGCCGCACCGGGAAGGGCAGGG - Intergenic
1168814678 20:728427-728449 CGGAGGCGGCGGGCGGGGCGAGG + Intergenic
1170962445 20:21037392-21037414 CTGCAGGGCCAGGAGGGGCAGGG + Intergenic
1171011945 20:21513735-21513757 CTGCCCCGGCGGGCGGGGGAGGG + Exonic
1171175892 20:23050489-23050511 CTGCGGCGCCGGGTAGGGGCGGG + Intergenic
1172118379 20:32584348-32584370 CAGCGGCGCGGAGGGGGGCAGGG + Intronic
1172474535 20:35226896-35226918 CGGCGGCGGCGGCGGGGGCAGGG + Exonic
1172655266 20:36532997-36533019 CTGCTGCTCCAGGCGGGGCTGGG + Intergenic
1173606605 20:44336330-44336352 CTGCGCCGCCAGGTGGGCCAGGG + Intergenic
1173874897 20:46364229-46364251 CTGAGGCCCGGGGAGGGGCAGGG + Intronic
1174404247 20:50293426-50293448 CTGCGGTGTCGGGCGGAGCTGGG + Intergenic
1174494739 20:50931325-50931347 CGGCGGCAACGGGCGGGGGAGGG + Intergenic
1174804670 20:53594430-53594452 CGGCGGCGGGGGGCGGAGCAGGG - Intronic
1175267075 20:57709591-57709613 CGGCGGCGCGGCGCGGGGCGCGG + Exonic
1175284536 20:57829107-57829129 CTGAGGGGCAGGGCAGGGCAGGG + Intergenic
1175443798 20:59007259-59007281 CTTAAGGGCCGGGCGGGGCAGGG - Intergenic
1175517207 20:59577347-59577369 CTGCGGCTCCGGGCGGGTCAAGG + Intergenic
1175873840 20:62220362-62220384 TGCCGGCGCCGGGCGGGGCGGGG - Intergenic
1175926545 20:62474236-62474258 CGCCGGCGCCGGGCCGGGCCTGG - Intronic
1175927116 20:62476306-62476328 CTTCGGCGGGGGCCGGGGCAGGG - Intergenic
1175932655 20:62500028-62500050 CTGGGGCTCCGGGCTGGTCACGG - Intergenic
1175977222 20:62717070-62717092 CTGAGGCCCAGAGCGGGGCAAGG + Intronic
1175992945 20:62798444-62798466 AGGCTGCGGCGGGCGGGGCAAGG - Intronic
1176016617 20:62937394-62937416 CGGCGGCGCGGGGCAGGGCCGGG - Intronic
1176550169 21:8217368-8217390 CGGCGGCGGCGGGCGGCGGAGGG + Intergenic
1176577011 21:8444638-8444660 CGGCGGCGGCGGGCGGCGGAGGG + Intergenic
1176733363 21:10521463-10521485 CTGCGGCGGCGGGCGGAACGGGG + Intergenic
1176862038 21:14016003-14016025 CTGCCCCGCCTGTCGGGGCAGGG - Intergenic
1178992770 21:37368099-37368121 CGGCGGGGCCGGGCCGGGCCGGG + Intronic
1179445232 21:41426181-41426203 TCGCGGCGCGGGGCGGGGCTGGG + Intronic
1179522470 21:41954021-41954043 CCGCGGGGCGGGGCGGGGCGGGG + Intergenic
1180259756 21:46661406-46661428 CTGGGGCGCCAGGCAGGGCGGGG - Intronic
1180481807 22:15761335-15761357 CAGCGGGGCGGGGCGGGGCGGGG + Intergenic
1181126299 22:20703918-20703940 CTGTGGGGCCGGGCCGGGCTGGG + Intergenic
1181299150 22:21867270-21867292 CTGCGGCCCCGGGCGGTGGGGGG + Intronic
1181478126 22:23180921-23180943 CTGCGCCGCCGGGCTGCGCGCGG - Exonic
1181543040 22:23584097-23584119 CTGCGGGGCTGGGCTGGGCCGGG + Intergenic
1181556053 22:23672238-23672260 CTGCTGAGCAGGCCGGGGCAGGG - Intergenic
1181696029 22:24593137-24593159 CTTCGGACCCGGACGGGGCAGGG - Intronic
1181698326 22:24606415-24606437 CTGCTGAGCAGGCCGGGGCAGGG + Intronic
1182401368 22:30080256-30080278 CTGAGGGGCCGGGCGGGCTAGGG + Exonic
1183606020 22:38867028-38867050 CTGCGGGTCCGGGCGGGGCAGGG + Exonic
1183607040 22:38872008-38872030 CGGCGGCGCGGGGCTGGGCGAGG + Intronic
1183702480 22:39457930-39457952 CTCCGGCGCGGCGCGGGGCTGGG + Intronic
1183893702 22:40951156-40951178 GGGCGGGGCCGGGCGGGGCCGGG - Intergenic
1184073435 22:42161260-42161282 GGGCGGGGCGGGGCGGGGCAGGG + Exonic
1184117742 22:42431915-42431937 CTGGGGCCAGGGGCGGGGCAGGG - Intronic
1184412231 22:44331877-44331899 CGGCGGCGGCGGGCGCGGCGCGG - Intergenic
1184417424 22:44360442-44360464 CTGCAGCCCCGGGTGGGGCAGGG - Intergenic
1184465783 22:44668474-44668496 GGGCGGCGCCCGCCGGGGCAGGG - Intergenic
1184465867 22:44668689-44668711 CGGCGGAGCGGGGCGGGGCGGGG + Intronic
1185179321 22:49350117-49350139 CTGCGTGGCCTGGCGTGGCACGG - Intergenic
1185268762 22:49918776-49918798 CTGCCGCGCCGGGCCGCGCTGGG + Exonic
1185333278 22:50261045-50261067 CTGTGGGGCCGGGCGGGGGTCGG - Intronic
1185335800 22:50270392-50270414 CGGCGGCGGCGGGCGGGGCGGGG + Exonic
1185398634 22:50604875-50604897 CTGCGGCGCTGTGCTGGGCTGGG + Exonic
1203255064 22_KI270733v1_random:133706-133728 CGGCGGCGGCGGGCGGCGGAGGG + Intergenic
1203263120 22_KI270733v1_random:178785-178807 CGGCGGCGGCGGGCGGCGGAGGG + Intergenic
949552402 3:5122254-5122276 CGGCGGCGCCGGGACGGGCGTGG + Exonic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950400946 3:12768884-12768906 TGGCGGGGCGGGGCGGGGCAGGG + Intronic
951078496 3:18425081-18425103 GCGCGGAGCCGAGCGGGGCACGG - Intronic
953694415 3:45146410-45146432 CTGCTGCGCAGGGCGGGGCTCGG - Exonic
953924732 3:46976889-46976911 GGGCGGGGCGGGGCGGGGCAAGG - Intronic
953982776 3:47420892-47420914 CTGAGGAGGCGGGCAGGGCAGGG + Intronic
954224047 3:49171557-49171579 CTCCGGCGCGGGGCGGGGCTGGG - Intergenic
954256489 3:49411492-49411514 CAGCGGCGCCGGGCAGGGCGGGG - Intronic
954382508 3:50227234-50227256 GTGGGGCCCCGCGCGGGGCAAGG + Intronic
954387752 3:50253194-50253216 CTGAGGGGCTGGGCAGGGCAGGG + Intronic
954540870 3:51392230-51392252 CTGCGGCGGCGTGACGGGCACGG - Exonic
954717542 3:52533929-52533951 CGGCGGGGCGGGGCGGGGCGGGG + Intronic
954733572 3:52685884-52685906 CGGCGGCACCGGGAGGGGTAAGG - Intronic
955060295 3:55487465-55487487 CTGTGGCCCGGGGCGGGGGAAGG + Exonic
959078934 3:101779607-101779629 CGGCGGGGCGGGGCGGGGCGGGG + Intronic
960096750 3:113696664-113696686 CTGCGGCCGCGGGAGGGGCGGGG - Intergenic
961453759 3:127014404-127014426 CGGTGGTGCAGGGCGGGGCATGG - Intronic
961551584 3:127672927-127672949 CTGCAGAGCGGGGCGGGGCGGGG + Exonic
961599882 3:128052387-128052409 GCGCGGCGCGGGGCGGGGCCGGG - Exonic
962793965 3:138834965-138834987 GGGCGGCGCAGGGCGGGGCGGGG - Intergenic
964482777 3:157159566-157159588 CGGCGGCGGCGGGAGGGGAAAGG - Intronic
966181866 3:177196481-177196503 CGGGGGCGCCGGCCGGGGGAGGG - Intronic
966411800 3:179652976-179652998 CTGCAGCGTCAGGCGGGGCTGGG - Exonic
966696257 3:182793441-182793463 CCGGGGGGCCGGGCGGGGCGGGG + Intergenic
966808758 3:183825626-183825648 CGGCGGCGCGGGGCGGGCCGCGG - Intergenic
966849408 3:184155456-184155478 CGGCGGCGGCGGGCGGCGCTGGG + Exonic
966944974 3:184771363-184771385 CTGGGGCCCCGGGTGGGACAAGG + Intergenic
967055407 3:185825360-185825382 CAGCGGCGCGGGGCGGGGAGGGG - Intergenic
967129614 3:186458454-186458476 CTGAGGCGGTGGGCGGGGGAGGG + Intergenic
967352424 3:188528320-188528342 CTGGGGGGCGGGGAGGGGCAGGG - Intronic
968319060 3:197749820-197749842 CCGCGGCTGCGGGCGGGGCGGGG - Exonic
968552964 4:1233475-1233497 CTGCGGGGCCTGGAGCGGCAGGG - Intronic
968582964 4:1403469-1403491 CAGCGGCGCCGGGGGGCGCGGGG - Exonic
968663067 4:1806732-1806754 CTCCGGGGCTGGGCGGGGGAGGG + Intronic
968755189 4:2412047-2412069 CTGGGGCGCAGGCAGGGGCAGGG + Intronic
968901750 4:3435358-3435380 CTCCTGCGGAGGGCGGGGCACGG - Intronic
968942906 4:3648411-3648433 CTGCGGAGGCGGGCGGGGTCGGG - Intergenic
968981533 4:3852582-3852604 GTGCGGGGCGGGGCGGGGCGGGG - Intergenic
969115004 4:4865962-4865984 CTGCGGCGCAGGGAGGGGGCGGG - Intergenic
969394212 4:6910024-6910046 CTGCAGCGCCGGCCGAGGCGGGG + Intronic
969912841 4:10461264-10461286 CTGCGCCGCAGGGCGGGAAAGGG - Intergenic
970333143 4:15004208-15004230 CTGCGGCGCCGCGGGCGGCGGGG - Exonic
970456212 4:16226526-16226548 CTCCGGCGAGGGGCGGGGCGAGG - Exonic
971351873 4:25862811-25862833 CAGCGGCGCGGCGCGGGGCTCGG - Exonic
971876946 4:32319351-32319373 CTGCTGCGCCAGGGTGGGCATGG + Intergenic
972312167 4:37891431-37891453 CTCCGCGGCCAGGCGGGGCAGGG - Intronic
972632879 4:40857189-40857211 CGGCCGCGGCGGGCGGGGCAGGG - Intronic
972766038 4:42152623-42152645 CTGCGGCTGCGGGCGGGGTCCGG + Exonic
976236322 4:82900919-82900941 CTGCGGGGCCCGGCGGGCCGTGG + Intronic
979335264 4:119454965-119454987 CTTCGGGGCCGGGCGCAGCAAGG + Intergenic
981093342 4:140755850-140755872 CTGCGGCGCCGCCCGCGGCCTGG - Intronic
982257639 4:153466263-153466285 GTGCGGCGCGGGGCGGGGCGGGG + Intergenic
985113806 4:186571967-186571989 CTGTGGGGCGGGGCGGGGCAGGG + Intergenic
985129097 4:186723881-186723903 CGGCGCCGGCGGGCGGGGCCGGG - Intronic
985708367 5:1414436-1414458 GTGGGGGGCCGGGAGGGGCAGGG + Intronic
985727517 5:1523881-1523903 CTGGGGCGCCGAGCGGGGCCGGG + Exonic
985743458 5:1633638-1633660 AGGCGGCGGCGGTCGGGGCAGGG + Intergenic
985749329 5:1665436-1665458 CTGCAGGGCCAGGCGGGACAGGG - Intergenic
986081986 5:4404514-4404536 CTGCGGGGCAGGGCAGGGAAGGG - Intergenic
986199385 5:5567801-5567823 CAGCTGAGCCGGGCTGGGCAGGG - Intergenic
986208544 5:5648550-5648572 CTGCGCAGCAGGGTGGGGCACGG + Intergenic
987374028 5:17217870-17217892 CTGCGGGGCGGGGCGCGGCGCGG - Intronic
988796441 5:34656778-34656800 CTGGGGCGGGGCGCGGGGCAGGG + Intronic
989575391 5:42983028-42983050 CTCCAGAGCTGGGCGGGGCACGG - Intergenic
995140258 5:108727998-108728020 CTGGGGCGGCCGGCGGGGAACGG - Intergenic
996185259 5:120465570-120465592 CGGCGGCTCCGGGCGGGGGCGGG + Intronic
997583982 5:135034043-135034065 CTGCGGCGCCGGGCGGGCAGAGG + Exonic
998406937 5:141879190-141879212 CTGCGCGGCCTCGCGGGGCAGGG - Intronic
999129513 5:149272013-149272035 TTGCGGCGCCGGGCGGGAAAGGG + Intronic
999321745 5:150619530-150619552 CTGCAGAGCAGGGCGGGACAGGG + Intronic
999449075 5:151665113-151665135 CTGAGGCCCAGGGAGGGGCAGGG + Intronic
1001496105 5:172188450-172188472 CTGCGGCGACGGGCGGAGCCGGG - Intergenic
1001577056 5:172771325-172771347 CGGCGGCGCCTGGCCTGGCAGGG - Intergenic
1002170320 5:177371045-177371067 CCGCGGGGCGGGGCGGGGCGGGG + Intronic
1002522647 5:179800139-179800161 GGGCGGCGCAGGGCAGGGCAGGG + Intronic
1002526109 5:179816964-179816986 CAGCCGCGCGGGACGGGGCAGGG + Intronic
1004561984 6:16760622-16760644 GTGCGGCTGCGGGCGGGGAAGGG - Intronic
1005303833 6:24495242-24495264 CAGCGGCGCCGCTCTGGGCATGG + Exonic
1006047355 6:31308724-31308746 CTCCGGTGCCGGGCGGGACGTGG - Intronic
1006114956 6:31770607-31770629 GGGCGGGGCAGGGCGGGGCAGGG + Intronic
1006134886 6:31889174-31889196 CTGGGGGGCCGGGCGGGGGCTGG + Intronic
1006303882 6:33207828-33207850 CCGCGGCCCGGGGCGGGGAAGGG - Intergenic
1006512125 6:34527173-34527195 CTGCGCCGCGGGGCGGGGGGCGG + Intronic
1006630706 6:35427830-35427852 CTGCAGCGCCCGTAGGGGCAGGG - Exonic
1006913895 6:37582429-37582451 CTCCGGCCCAGGGCGGGGGAGGG - Intergenic
1007431508 6:41779897-41779919 CCGCGGGGCGGGGCGGGGCGGGG - Exonic
1007521283 6:42453027-42453049 CTGCTGCGCCTGCCGCGGCAAGG - Intergenic
1007680336 6:43629192-43629214 CGGCGGCGGCGGTCGGGGGAGGG - Intergenic
1007779807 6:44246381-44246403 CTCCGGCTGCGGCCGGGGCAGGG - Intronic
1008553594 6:52655734-52655756 ATGGGGCGGCTGGCGGGGCAGGG + Intergenic
1010302885 6:74282238-74282260 GTGCGGCGTGGGGCAGGGCAGGG + Intergenic
1011640443 6:89412198-89412220 CTCCGCCGGCGGGCGGGGCGGGG - Exonic
1011734444 6:90297041-90297063 CTGGGGCGGGGGGCGGGGGACGG + Intergenic
1013372596 6:109483363-109483385 GGGCGGGGCGGGGCGGGGCAAGG + Intergenic
1014098178 6:117482578-117482600 GTGCGGGGCGGGGCGGGGCCGGG + Intronic
1014205543 6:118651670-118651692 GCGCGGCGCCGCGCGGGGCGGGG + Intronic
1015750012 6:136550154-136550176 CGGCGGCGAAGGGCGGGGGAAGG + Intronic
1016982188 6:149863886-149863908 CAGCGGCGCCGCGGGCGGCAAGG + Exonic
1017739981 6:157398081-157398103 CTGGGGAGCCGGGGGGGGCTGGG - Intronic
1018027275 6:159816191-159816213 CTGCTGCCTGGGGCGGGGCAGGG - Intronic
1018400243 6:163414379-163414401 CTGCGGCGCTCGGCGGGCCTGGG - Intronic
1018686278 6:166307291-166307313 CTGCCGCGCGGGGCCGGGCGGGG - Exonic
1019111915 6:169723974-169723996 CGGCGGCGGCGGCCGGGACAAGG - Exonic
1019360342 7:601611-601633 CGGCGGGGCCGGGCGGGGCCGGG - Intronic
1019702812 7:2482251-2482273 CTGAGGCCCAGGGAGGGGCAAGG - Intergenic
1020105251 7:5419748-5419770 GTGAGGCGCCGGGCGGGGGAGGG - Intronic
1020178102 7:5898804-5898826 CTGCAGCGGCGGCCGGGGCCGGG + Exonic
1020262097 7:6536422-6536444 CTGCGGCAGCGGGTCGGGCAGGG - Intronic
1020304825 7:6826171-6826193 CTGCAGCGGCGGCCGGGGCCGGG - Exonic
1021223838 7:18005227-18005249 CCACGGCGCCCGGCTGGGCATGG + Intergenic
1022471154 7:30682528-30682550 CTGCGCCGGGGGGCGGGGCCGGG + Intronic
1023791864 7:43758894-43758916 CTCCGGGCCCGGGCGGGGCGGGG - Intronic
1023972378 7:45000478-45000500 TGGCGGGGCGGGGCGGGGCAGGG + Intronic
1024068815 7:45768806-45768828 CTTCGGGGCCGGGCGCAGCAAGG - Intergenic
1025098503 7:56116167-56116189 CTGCGGGGCAGGGCGCAGCAAGG - Exonic
1025139099 7:56448061-56448083 CTTCGGCGCAGGGTGGGGCTGGG - Intergenic
1025990586 7:66493859-66493881 CTGCGGCGTAGGGCGCAGCAAGG + Intergenic
1027213238 7:76166848-76166870 CTGCGGCGTAGGGCGCAGCAAGG + Intergenic
1028223193 7:88220079-88220101 CGGCAGGGCGGGGCGGGGCAGGG - Exonic
1029080756 7:97972228-97972250 CTGCAGCGGCGGCCGGGGCTGGG - Intergenic
1029238739 7:99143830-99143852 CGGCGGGGCCGGGCCGGGCCGGG - Exonic
1029440804 7:100585803-100585825 CTCCCGGGCCGGGCGGGGCCCGG + Intronic
1029490041 7:100866054-100866076 CTGCGGCCCCGGGGTGGGCCCGG + Exonic
1029690016 7:102175143-102175165 CTCCTGCGCCCGGCTGGGCATGG - Intronic
1029699024 7:102234249-102234271 CAGCCGGCCCGGGCGGGGCAGGG - Intronic
1031485008 7:122315159-122315181 CGGCGGCACAGGGTGGGGCAAGG - Intergenic
1032279916 7:130492015-130492037 CTGCGGCGATGGGCGGGCTAGGG + Intronic
1032391290 7:131556722-131556744 CGGCCGGGCCGGGCGGGGCCGGG + Intronic
1034470399 7:151251719-151251741 CTGCGGCGCCGGGCGCCGGGCGG - Intronic
1034503816 7:151469460-151469482 CTGCGGAGAGGGGCGGGGCAGGG + Intronic
1034578932 7:152025942-152025964 CGGCGGCGGCGCGCGGGGCCTGG + Intronic
1034610824 7:152366860-152366882 CTGCAGAGCCGGGCGCAGCAAGG + Intronic
1034620284 7:152451662-152451684 CTGCGGCGGGGGGCGGGGGGGGG - Intergenic
1034976064 7:155449828-155449850 CTGCGGCACCGCGCTGCGCAGGG - Intergenic
1035091956 7:156320092-156320114 CTGCTGCACCGGGCCAGGCATGG - Intergenic
1035171832 7:157021486-157021508 CTGAGGCGGAGGGCGGGGCCCGG - Intergenic
1035265967 7:157690524-157690546 CAGGGGTGCCGGGCGGGGCGCGG - Intronic
1036739429 8:11347592-11347614 TTGGTGCGCCGGGCGGGGCGGGG + Intergenic
1036788418 8:11702785-11702807 CTGGGGCGCCGAGCGGCGAAAGG - Intronic
1037339664 8:17831104-17831126 GTGTGGTGCTGGGCGGGGCACGG + Intergenic
1037803917 8:22049149-22049171 CTGCGGAGCCCGGCGGAGCCCGG + Intronic
1038002774 8:23404839-23404861 CTGAGGCTCCGGGTGGGGGATGG + Intronic
1038035412 8:23682635-23682657 CTCCGGCGCGGCGCGGGGCCCGG + Exonic
1038041450 8:23727135-23727157 CGGCGGCCCCGGGCGGGTCAGGG + Intergenic
1038304112 8:26383517-26383539 CAGCGGAGCCGGGCGGGGCGGGG + Intronic
1038326618 8:26577281-26577303 CTCCGGGGCCGGGCGTGGCCGGG + Intronic
1038761200 8:30385037-30385059 CTGGGGCGCGGGGCTGGGCGAGG - Exonic
1038761212 8:30385060-30385082 CTTCCTCGCCGGGCCGGGCAGGG - Exonic
1038883665 8:31640289-31640311 CGGCGGCGGCGGGCGAGGCAGGG + Intronic
1039476452 8:37841626-37841648 CTGCGGCGGCGGGCAGGGCCCGG - Exonic
1039484403 8:37899621-37899643 CGGCGGGGCGGGGCGGGGCGGGG - Intergenic
1039843266 8:41308555-41308577 CTGCAGCTCCGGCCGGGGGATGG + Intronic
1039996882 8:42541757-42541779 GGGCGGCGCGGGGCGGGGCCGGG - Intronic
1041090496 8:54297082-54297104 CTGCAGGGCAGGGCAGGGCAGGG + Intergenic
1041673679 8:60517091-60517113 CGGCGGCGGCGGGCGGCGCCTGG + Exonic
1041690067 8:60679316-60679338 TTGGGGCGCCGGGCGGCGCTCGG - Intronic
1042591596 8:70403035-70403057 CTGCAGCGCGGGGCGGGGAAGGG - Intronic
1044591517 8:93917509-93917531 GGGCGGGGCCGGGCCGGGCAGGG + Intronic
1045216879 8:100157961-100157983 CTGCGGGTCGGGGCGTGGCAGGG + Intronic
1045269443 8:100649554-100649576 CTGCGGCGGCGGGCGGTGCGCGG + Exonic
1045510018 8:102806713-102806735 GTGCGGGGCCGGGCCGGGCTGGG + Intergenic
1048553919 8:135457397-135457419 GGGCGGAGCCGGGCGGGGCGGGG + Intergenic
1049186046 8:141254152-141254174 CTGCGGGTCCGGCAGGGGCACGG + Intronic
1049194528 8:141308132-141308154 CGGCCGGGCCGGGCCGGGCAGGG + Intronic
1049570616 8:143368808-143368830 CGGCGCGGCTGGGCGGGGCACGG - Intergenic
1049585419 8:143430536-143430558 CGGCGGCGCCGAGGGGCGCAGGG + Intergenic
1049675567 8:143887439-143887461 CTCGGGCGCCGGCCGGGGCTAGG - Intergenic
1049746845 8:144266624-144266646 CGGCGGCGCCGGGCGCAGCGTGG - Exonic
1049762277 8:144336908-144336930 CGGCGGCGGCGGGCGGGGGGCGG + Intergenic
1049766662 8:144358272-144358294 GCGCGGGGCCGGGCGGGGCCGGG + Exonic
1049788403 8:144462237-144462259 CTGCAGCCCCGGGCTGGGCCGGG + Intronic
1049801130 8:144517971-144517993 CCGCGGCGCCGGGCGGGGAGCGG + Intronic
1049816539 8:144605753-144605775 CTGCGGCGGTGGGCTGGGCCGGG - Intronic
1049936366 9:504773-504795 CCGCGGCACGGGGCGCGGCACGG - Intronic
1050377218 9:4985429-4985451 CTGCGGCGCAGGGAGAGGCCTGG + Exonic
1053143662 9:35697640-35697662 CTGCGGGACTGGGCGGGGCCAGG + Exonic
1053545779 9:39021401-39021423 CTGGGGAGACGGGCTGGGCACGG - Intergenic
1057313507 9:93955412-93955434 CGGCGGCGCGGGGCGGGGCGGGG - Intergenic
1057995643 9:99820061-99820083 ACGCCGCGCGGGGCGGGGCAGGG - Intergenic
1058424193 9:104862630-104862652 CTGCCGGGCCGGGCCGGGCCGGG + Intronic
1058432092 9:104928430-104928452 CGGCGGGCCCGGGCGGGGGAAGG - Intergenic
1058663021 9:107283437-107283459 CAGCGGCGCGGTCCGGGGCACGG + Exonic
1059102441 9:111483668-111483690 CGGCGGCGGCGGGCGGGCCTCGG - Intronic
1059414366 9:114154207-114154229 CAGCGGCACCGGGAGGGGCATGG - Intergenic
1060192047 9:121599543-121599565 CGGCGGCGCCGGGGGAGGCGCGG + Intronic
1060629447 9:125143123-125143145 GCGCGGGGCCGGGAGGGGCAAGG - Intronic
1060811679 9:126614087-126614109 CGGCGGCGGCAGGCGGGGGAGGG - Intergenic
1061108676 9:128552139-128552161 CTGCGGAGAAGGGCGGGGCGGGG - Intergenic
1061147096 9:128806383-128806405 CTGCTGCGACAGGCTGGGCAGGG + Intronic
1061208699 9:129178482-129178504 CTGCCGCGCCGCGCGGGACTCGG + Intergenic
1061453419 9:130681221-130681243 CCGCGGGGCGGGGCGGGGCGGGG - Intronic
1061807133 9:133142812-133142834 CTGCTGGGCAGGGCGGGGCTGGG - Intronic
1061849767 9:133407490-133407512 CAGCAGGGCCGGGCAGGGCAGGG + Intronic
1061859362 9:133460245-133460267 CGCCGGGGCGGGGCGGGGCAGGG - Intronic
1061976023 9:134068292-134068314 GTGCGGGCCCGGGCGGGGAACGG - Intronic
1062022556 9:134326350-134326372 CTGCGGCGCCGGCGGGGGGGTGG - Intronic
1062043946 9:134416641-134416663 CTGCGGCGGGGGGCGGGGGAGGG - Intronic
1062146297 9:134991592-134991614 CTGTGGCGCTGGGCTGGCCATGG + Intergenic
1062288727 9:135785246-135785268 CTGAGGCGGCGTGGGGGGCAGGG + Intronic
1062290384 9:135791736-135791758 CTGCAGAGCTGGGAGGGGCAGGG + Intronic
1062364734 9:136203225-136203247 CCGCGGGGCGGGGCGGGGCCGGG + Intronic
1062364856 9:136203667-136203689 CTGCGGCCCCGGACGGCTCAGGG + Intronic
1062365210 9:136205091-136205113 CCGCCGCGTCGTGCGGGGCAGGG + Intronic
1062467439 9:136687448-136687470 CGGCGGGGCTGGGCGGGGCGGGG + Intergenic
1062501580 9:136854196-136854218 CTGGGGGGCTGGGTGGGGCAGGG - Exonic
1062529158 9:136992387-136992409 CTTGGGCGCCGGGAGGGGCGGGG - Intergenic
1062544243 9:137054464-137054486 CTGCGGAGCCACGCGGGGCCCGG + Intergenic
1062551177 9:137087278-137087300 CTGCGGCTCCGAGCGGGACCTGG + Intronic
1062558675 9:137129432-137129454 CTGCGGCTCCGAGCGGGGCCTGG - Intergenic
1062614850 9:137391633-137391655 AGGCGGGGCGGGGCGGGGCAGGG - Intronic
1062696400 9:137878228-137878250 GGGCGGGGCCGGGCGGGGCCGGG + Intronic
1185433003 X:20042-20064 CTGCGCGGCGGGGCGGGGCGGGG + Intergenic
1188005170 X:25011985-25012007 CTGGGGCGCCGGCCCGGGTAGGG - Intronic
1189332873 X:40153920-40153942 CTGCCGCGCCGTGGGGGGCAGGG + Intronic
1190339582 X:49286195-49286217 CTGTGGCTGCGGGTGGGGCAGGG + Exonic
1191861151 X:65667545-65667567 AGGCGGGGCTGGGCGGGGCAAGG + Intronic
1195728044 X:107937195-107937217 CCGGGGCGCGGGGCGGGGGACGG - Intergenic
1196684087 X:118495947-118495969 CAGCGGCGGCGGGCGGGTCTCGG - Exonic
1198398843 X:136250966-136250988 CTGCTTCGACGGGCGGGGCGGGG - Intronic
1198767145 X:140091495-140091517 CTGAGCCGGCGGGCGGGGCGGGG + Intergenic
1200102119 X:153693404-153693426 CTGCTGGGCAGGGCGGGGCAGGG - Intronic
1200138536 X:153886267-153886289 CGGCGGGGCGGGGCGGGGCGGGG - Intronic
1200173704 X:154097453-154097475 CGGCGGCGGCGGGAGGGGGAGGG + Intronic
1200240511 X:154490690-154490712 CTGACGCGCGGGGCGGGGAAGGG - Exonic