ID: 1126163514

View in Genome Browser
Species Human (GRCh38)
Location 15:45634925-45634947
Sequence CGGCGCCGGGCGGGGCACGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1050
Summary {0: 1, 1: 0, 2: 7, 3: 118, 4: 924}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163496_1126163514 30 Left 1126163496 15:45634872-45634894 CCCCGTGAGCGCTCAACGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1126163514 15:45634925-45634947 CGGCGCCGGGCGGGGCACGGCGG 0: 1
1: 0
2: 7
3: 118
4: 924
1126163506_1126163514 -6 Left 1126163506 15:45634908-45634930 CCATGGTGCCTGGGCTGCGGCGC 0: 1
1: 0
2: 2
3: 19
4: 253
Right 1126163514 15:45634925-45634947 CGGCGCCGGGCGGGGCACGGCGG 0: 1
1: 0
2: 7
3: 118
4: 924
1126163501_1126163514 11 Left 1126163501 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1126163514 15:45634925-45634947 CGGCGCCGGGCGGGGCACGGCGG 0: 1
1: 0
2: 7
3: 118
4: 924
1126163497_1126163514 29 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163514 15:45634925-45634947 CGGCGCCGGGCGGGGCACGGCGG 0: 1
1: 0
2: 7
3: 118
4: 924
1126163499_1126163514 28 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163514 15:45634925-45634947 CGGCGCCGGGCGGGGCACGGCGG 0: 1
1: 0
2: 7
3: 118
4: 924
1126163500_1126163514 12 Left 1126163500 15:45634890-45634912 CCCTGGTGTGTTCACTGACCATG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1126163514 15:45634925-45634947 CGGCGCCGGGCGGGGCACGGCGG 0: 1
1: 0
2: 7
3: 118
4: 924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163514 Original CRISPR CGGCGCCGGGCGGGGCACGG CGG Exonic
900000284 1:11052-11074 CGGCGCCGGGCTGGGGCGGGGGG + Intergenic
900019989 1:181566-181588 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
900113891 1:1020567-1020589 CGGCGGCGGGCGGAGGACGGCGG - Intronic
900116940 1:1033043-1033065 CGGCCCGGGGCGGGGAATGGGGG - Intronic
900138093 1:1127240-1127262 CTGCGGCGGGCCGGGCACAGTGG - Intergenic
900180212 1:1307935-1307957 CGGGGCGGGGCGCGGCGCGGCGG - Exonic
900349496 1:2227981-2228003 CGGCGCGGGGCGGGGCGGCGCGG + Intergenic
900393452 1:2443682-2443704 CCGCGCCGGGAGGGGGCCGGGGG - Intronic
900583983 1:3423617-3423639 CGGCACCGGTCGGGGCGGGGTGG + Intronic
901019791 1:6249804-6249826 CGGCGGCGCGCGCGGGACGGTGG + Exonic
901050722 1:6424709-6424731 CGGGGCGGGGCGGGGCGGGGTGG + Intergenic
901242822 1:7704803-7704825 CCGGGCCGGGCGGGGCCGGGCGG + Intronic
901332765 1:8423723-8423745 CCGCGCGGCGCGGGGCCCGGGGG + Intronic
901443493 1:9293189-9293211 TGGCGCGGGGCCGGGCGCGGGGG + Intronic
901630398 1:10645241-10645263 CAGCGCAGGGCCGGGCGCGGTGG + Intronic
901641355 1:10694635-10694657 CGGCACCGGGCGGCGGGCGGCGG - Intronic
901696542 1:11012288-11012310 CGGGGCGGGGCGGGGCCTGGAGG - Intergenic
901833674 1:11909552-11909574 CGGGGCACGGCGGGGCACGGCGG - Intergenic
901833678 1:11909562-11909584 CGGGGCACGGCGGGGCACGGCGG - Intergenic
901833682 1:11909572-11909594 CGGGGCACGGCGGGGCACGGCGG - Intergenic
901833686 1:11909582-11909604 AGTCGCATGGCGGGGCACGGCGG - Intergenic
902044281 1:13513566-13513588 CGGCGCAGGCTGGGGCTCGGGGG + Exonic
902330728 1:15730050-15730072 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
902330731 1:15730055-15730077 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
902385593 1:16073686-16073708 GCGCGGCGGGCGGGGCCCGGGGG + Intergenic
902403799 1:16172385-16172407 TGGAGCCGGGTGGGGCATGGGGG - Intergenic
902600889 1:17539691-17539713 CGGCGCCGCGTCGCGCACGGCGG + Intergenic
902691189 1:18110823-18110845 TGGCGCCGGGCTGGGGATGGAGG + Intronic
902998068 1:20243085-20243107 CGGGGCAGGGCGGAGGACGGGGG - Intergenic
903184745 1:21622609-21622631 CGGCGCGGGGCGGGGCGGGGCGG + Intronic
903263328 1:22142812-22142834 CGGGGCCGAGCGGGGCGGGGCGG - Intronic
903466391 1:23554971-23554993 GGGCGCCGGGAGGGGCGGGGCGG + Intergenic
903597135 1:24503160-24503182 CAGCGCGGGGCGGGGCGGGGCGG + Intronic
903597138 1:24503165-24503187 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
904541956 1:31239447-31239469 CGGGGCAGGGTGGGGCGCGGCGG - Intronic
904769050 1:32870861-32870883 CGGCTCGGGGCGGCGCAGGGCGG - Intronic
904775119 1:32901522-32901544 CGGCGCCGGGCGGGCCGGGCGGG - Intergenic
904822753 1:33256252-33256274 GGGGGCCGGGCGGGGGGCGGGGG - Intergenic
905212813 1:36385969-36385991 AGGCGGAGGGCGGGGCCCGGGGG - Intergenic
905789837 1:40784068-40784090 CGGCGCCGGGCTGGGGGCGCCGG - Exonic
905790293 1:40785825-40785847 CGGCACAGGGAGGGGCAGGGGGG + Intronic
905912253 1:41662707-41662729 CGGAGCCGGGGCGGGCGCGGAGG - Intronic
906116136 1:43358716-43358738 CGGGGCAGGGCGGGGCCGGGTGG - Intergenic
906116141 1:43358726-43358748 CGGGACAGGGCGGGGCAGGGCGG - Intergenic
906627037 1:47333877-47333899 CGGCGCGGGGCGGGGCGGGGAGG - Exonic
906627040 1:47333882-47333904 CGGCGCGGCGCGGGGCGGGGCGG - Exonic
906650327 1:47508285-47508307 CCGCGGGGGGCGGGGCGCGGTGG + Intergenic
906961424 1:50421492-50421514 CGTCGCCGCGCCGGGCACGCTGG + Exonic
907069313 1:51519376-51519398 CGGGGCCAGGCGGGGCGGGGCGG - Intergenic
907368142 1:53979526-53979548 GGGCGGCAGGCAGGGCACGGTGG + Intergenic
907404016 1:54242660-54242682 CCGCGTCAGGCCGGGCACGGTGG + Intronic
908195374 1:61742399-61742421 CCGCCCGGGGCGGGGCACCGGGG - Intergenic
908477631 1:64505531-64505553 CGGGGCGGGGCGCGGCCCGGGGG - Intronic
908477761 1:64505852-64505874 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
910221493 1:84893248-84893270 CGGGGCGGGGCGGGGCAGGGAGG - Intergenic
910759096 1:90717995-90718017 CGGCGCGGCGCGGGGAGCGGCGG - Intergenic
910787993 1:91021651-91021673 CGCCGCGGGGCGGGACTCGGCGG - Intronic
911658781 1:100476163-100476185 CAGCTCTGGGCTGGGCACGGTGG + Intronic
912354290 1:109042231-109042253 CGGGGCGGGGCGGGGCGGGGAGG + Intergenic
912492151 1:110068369-110068391 CGGCGCAGCGCGGCGCGCGGTGG - Intronic
912800177 1:112715306-112715328 CGGCCGAGGGCGGGGCAGGGAGG - Exonic
912818140 1:112846330-112846352 GAGCGCCGGGCCGGGCGCGGTGG - Intergenic
913047951 1:115089545-115089567 GGGGGCGGGGCGGGGCCCGGCGG + Intergenic
915448303 1:155987448-155987470 CGGCTCCAGGCTGGGCATGGTGG + Intronic
915519918 1:156436173-156436195 CGGCGGCGGGCAGCGCGCGGAGG - Intergenic
915589135 1:156860788-156860810 CGGGGCCGGGCGGGGGCCGCTGG + Intronic
917456811 1:175192819-175192841 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
918388809 1:184037249-184037271 CGTCGCCGAGCGGGACTCGGAGG - Exonic
919101835 1:193105461-193105483 CGGGACGGGGCGGGGCAAGGCGG - Intronic
919822178 1:201480540-201480562 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
919822181 1:201480545-201480567 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
919822184 1:201480550-201480572 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
919822255 1:201480841-201480863 CGGGGCTGGGCGTGGCACGGAGG + Intergenic
920260574 1:204685386-204685408 CGGGGCCGGGCTGGGGACGCTGG + Intronic
920648164 1:207818277-207818299 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
920648167 1:207818282-207818304 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
920648170 1:207818287-207818309 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
920648173 1:207818292-207818314 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
920648176 1:207818297-207818319 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
920648179 1:207818302-207818324 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
920648198 1:207818342-207818364 CGGGACGGGGCGGGGCAGGGCGG + Intergenic
921060368 1:211579417-211579439 CGGAGCCGGGCGTGGGCCGGGGG + Intergenic
921167132 1:212515239-212515261 CGGGGCGGGGCGGGGCGGGGGGG - Intergenic
921167137 1:212515244-212515266 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
921167140 1:212515249-212515271 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
921355567 1:214281446-214281468 CGGCGGCGGGCGGGAGCCGGGGG + Intronic
922958612 1:229625999-229626021 CGGCGGGGCGCGGGGCGCGGGGG - Exonic
923505296 1:234600233-234600255 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
923505305 1:234600243-234600265 CGACCCCGGGCGGGGCGGGGCGG - Intergenic
923626374 1:235617033-235617055 CGGCACTGGGCAGGGCACAGTGG - Intronic
923684159 1:236142438-236142460 CGGGGCCGGTCGGCGCGCGGGGG + Intergenic
924362323 1:243254863-243254885 CGGCGCCGCGCGGAGCACCCGGG + Intronic
924415176 1:243850313-243850335 CGGCGGCGGGAGGGGGAGGGAGG + Intronic
924527090 1:244863108-244863130 AGGAGCCGGGCGGGGCGGGGCGG - Intronic
924728244 1:246689805-246689827 GGGCGCCGGGCTGGGCGGGGAGG - Intergenic
924957632 1:248944760-248944782 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1062843908 10:690043-690065 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1064443179 10:15371294-15371316 CGGCGGCGGGCGAGGCAGGAAGG - Intergenic
1065025240 10:21534554-21534576 GGGCGCCGGGGCGGGCTCGGGGG + Intronic
1065025372 10:21535069-21535091 CGGGGCGGGGCGGGGCAGGGCGG + Intronic
1065099569 10:22320743-22320765 CGGGGCCGGCCGGGGGGCGGCGG + Intronic
1066299997 10:34088122-34088144 CAGCACCAGGCTGGGCACGGTGG + Intergenic
1066698084 10:38095897-38095919 CTGGGCTGGGCTGGGCACGGTGG + Intronic
1067115922 10:43435713-43435735 CGACACCAGGCCGGGCACGGTGG + Intergenic
1067741150 10:48896977-48896999 CAGCGCCAGGCTGGGCATGGGGG + Intronic
1068017384 10:51534379-51534401 CGGCTCTGGGCTGGGCGCGGTGG + Intronic
1068637395 10:59362675-59362697 CAGAGCTGGGCGGGGCGCGGCGG + Intronic
1068697127 10:59979789-59979811 TGGGGCCTGGCCGGGCACGGTGG + Intergenic
1068790926 10:61030244-61030266 TGGCTCCAGGCTGGGCACGGTGG + Intergenic
1069771125 10:70901276-70901298 CAGCCCATGGCGGGGCACGGGGG - Intergenic
1070570736 10:77637995-77638017 CGGAGCCGGGGCGGGCCCGGGGG - Intronic
1070691915 10:78533346-78533368 CGGGGCCTGGAGGGTCACGGGGG - Intergenic
1070752808 10:78973953-78973975 CTGGGCCGGGCGGGGCCGGGAGG - Intergenic
1070895781 10:79982141-79982163 GCGCGCCTGGCGGGGCAGGGCGG + Intronic
1072027611 10:91476891-91476913 CGGGTCCGGGCCGGGCGCGGTGG + Intronic
1072555955 10:96513769-96513791 CGGCTCCGGCCGGGACTCGGTGG + Exonic
1072660016 10:97358045-97358067 CAGTTCAGGGCGGGGCACGGTGG + Intronic
1072812673 10:98475404-98475426 TGGTCCCGGGCTGGGCACGGTGG - Intronic
1072875535 10:99169216-99169238 CTGAGCCAGGCTGGGCACGGTGG + Intronic
1072970051 10:100009785-100009807 GGGGGCCGGGCGGGGAGCGGGGG - Intronic
1073044606 10:100629254-100629276 TGGGGCCTGGCCGGGCACGGTGG + Intergenic
1073049187 10:100656687-100656709 CCGCGGCGGGCGGGGCGCAGCGG + Intergenic
1073076690 10:100828919-100828941 CGGGGCCGGGCGGGGCGGGGCGG - Exonic
1073095122 10:100974822-100974844 CGGCCCTGGGCTGGGCATGGTGG + Intronic
1073137639 10:101228768-101228790 CGGCGCCGGGGGAGGAGCGGCGG - Exonic
1073214696 10:101829803-101829825 GGGGGCGGGGCGGGGCAGGGCGG - Intronic
1073392840 10:103193310-103193332 CGGCGCGGGGCGGTGCCGGGCGG - Intergenic
1074591897 10:114821791-114821813 CGGCACCGGTTGGGACACGGTGG - Exonic
1074772363 10:116742381-116742403 CCGCGGCTGGCGGGGCAGGGAGG - Intronic
1074772435 10:116742635-116742657 GGGCGCCGGGCGGGCCGGGGCGG - Intergenic
1075430398 10:122375122-122375144 CGGCGCCCGGCGGGGGAGGGCGG + Intronic
1075501737 10:122980725-122980747 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1075501740 10:122980730-122980752 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1075501743 10:122980735-122980757 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1076678014 10:132158074-132158096 CGGGGCGGGGCGGGGCGGGGGGG - Intronic
1076678019 10:132158079-132158101 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1076721931 10:132396760-132396782 GGGCGCAGGGCTGGGCCCGGAGG + Intergenic
1076734700 10:132453344-132453366 GGCCGCGGGGCGGGGCCCGGGGG + Intergenic
1076883831 10:133252370-133252392 GGGTGCAGAGCGGGGCACGGTGG - Intergenic
1076889470 10:133276724-133276746 GGGCGCAGCGCGGGGCAGGGTGG - Intronic
1076908283 10:133373792-133373814 AGGCGCAGGGCCAGGCACGGTGG + Intergenic
1076963475 10:133786278-133786300 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1077043655 11:535262-535284 TGGGGCCGGGCGGGGCCCGCGGG - Intronic
1077065543 11:639577-639599 GGGCGGCGGGCGGGGCGCGGGGG - Intronic
1077079928 11:720753-720775 CGGTGCCGGGCGGGGCAGGGTGG + Intronic
1077090746 11:777258-777280 GGGCGCCGGGCAGGGGCCGGGGG - Intronic
1077107887 11:849797-849819 GGGCGCGGGGCGGGGCGCGCGGG + Intronic
1077214742 11:1390602-1390624 CGGCGCGGCGCGGGGCGCGCAGG + Intronic
1077419896 11:2445161-2445183 AGGCGCCCGGCGGGGCAGCGCGG + Exonic
1077886313 11:6390511-6390533 CGGCGCCGCCCGGGGCCCTGAGG + Exonic
1077910961 11:6571052-6571074 CAGCGGCGGGAGGGGCACGGGGG - Exonic
1078347813 11:10566395-10566417 GGGGGCCGGGTTGGGCACGGTGG - Intronic
1078594321 11:12674129-12674151 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1079090476 11:17476890-17476912 CGGGGCTGGGCGGGGCCCGGGGG - Intergenic
1079126372 11:17720917-17720939 CGCCGCCGGGCGCCGCTCGGGGG - Exonic
1079202530 11:18387811-18387833 CGGCCACGGGCTGGGCACAGTGG + Intergenic
1079277893 11:19058711-19058733 AGGTGCAGGGCCGGGCACGGTGG - Intronic
1080045781 11:27806309-27806331 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1081710024 11:45210466-45210488 CTGCAGCTGGCGGGGCACGGGGG - Intronic
1083107447 11:60372362-60372384 GGGCCCAGGGCCGGGCACGGTGG + Intronic
1083177709 11:60961972-60961994 TGGCGCCAGGCTGGGCACGGTGG + Intergenic
1083336086 11:61922699-61922721 CTGGGCGGGGCGGGGCAGGGTGG - Intergenic
1083560622 11:63670914-63670936 CTGCCCAGGGCGGGGCTCGGCGG + Intronic
1083618036 11:64036005-64036027 CGGCGCGCGGCAGAGCACGGTGG - Intronic
1083758400 11:64803199-64803221 CGGCGCGGGGCGGCGCGGGGCGG + Exonic
1083885632 11:65572298-65572320 GGGGGCGGGGCGGGGCGCGGCGG + Intronic
1083904792 11:65662670-65662692 TGGCGCGGGGCGGGGCAGGCGGG - Intronic
1083920893 11:65780984-65781006 CGGGGCGGGGCGCGGCGCGGGGG + Intergenic
1083965734 11:66042665-66042687 CGGCGCCGGCCCGGCCACCGAGG - Exonic
1084028452 11:66467058-66467080 CTGCGCCAGGCGGGCCCCGGCGG + Intronic
1084083358 11:66843351-66843373 CGGGCCCGGGCGGGGCGGGGCGG + Intronic
1084399355 11:68934747-68934769 CCGGGCAGGGCGGGGCAAGGTGG - Intronic
1085205782 11:74731234-74731256 CAGCGCCGGGCGAGGCGCGCGGG + Intronic
1085284637 11:75351749-75351771 GGGCGGCGGGCGGGGACCGGGGG - Intergenic
1085982781 11:81744655-81744677 CCCCGCCGGGCAGGGCTCGGGGG - Intergenic
1086362060 11:86069363-86069385 AGACGCCGGGCGGGGCGGGGCGG + Intronic
1088679461 11:112226614-112226636 CGGGCCCGGGAGGGGCGCGGGGG + Intronic
1089607360 11:119649091-119649113 AGGCTCCAGGCCGGGCACGGTGG + Intronic
1089622252 11:119728806-119728828 CGGCGCCGGGAGGAGAGCGGAGG - Exonic
1089700212 11:120240102-120240124 CGGCGCGGGGCGGGGGCCGCCGG - Intronic
1090211061 11:124921336-124921358 CGGCGAGCGGCCGGGCACGGCGG + Exonic
1090350794 11:126106433-126106455 CGGTGCCAGGCTGGGCACAGTGG - Intergenic
1090768264 11:129895622-129895644 CAGCGCGGGGCGGGGCCTGGAGG + Intergenic
1090784119 11:130033295-130033317 CGGGGCCGCGCGGGGCATGCCGG - Intergenic
1091286636 11:134411978-134412000 CGGGGCCGGGCGGGGCGGGCGGG - Intergenic
1091373369 12:11180-11202 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
1091381795 12:66747-66769 CGGCGCCGGCGGGGGGAGGGAGG + Exonic
1091567899 12:1661872-1661894 CGGCGGGGGGCGGGGGGCGGGGG + Intergenic
1091616223 12:2053029-2053051 CGGCGCTCGGCGCGGCGCGGCGG + Intronic
1092155430 12:6278910-6278932 CGGGGCGGGGCGGGGCACCCCGG - Intergenic
1092461982 12:8695197-8695219 CGGGGCCGGGCGGGGCGGGGCGG - Intronic
1093516202 12:19989703-19989725 TGGTGCCTGGCCGGGCACGGTGG + Intergenic
1094064223 12:26346333-26346355 CTGCGCTGGGCCAGGCACGGTGG + Intronic
1094199266 12:27780236-27780258 CGGTTCCGGGCGGGGCGCCGAGG - Exonic
1095206159 12:39442889-39442911 CGGCGGCGGGCGGCGGGCGGCGG - Intronic
1095966624 12:47871750-47871772 CAGTGCCTGGCTGGGCACGGTGG - Intronic
1096255056 12:50057742-50057764 CGGAGCCGAGCGGGGCCGGGCGG + Exonic
1096500517 12:52061761-52061783 CGGGGCAGGGTGGGGCAGGGTGG - Intergenic
1096675053 12:53221736-53221758 CGGCTGAGGGCGGGGCGCGGGGG - Intronic
1097034654 12:56115567-56115589 CGTCAGCGGGCTGGGCACGGTGG - Intergenic
1097155075 12:57006463-57006485 CCTCGTCGGGCCGGGCACGGCGG - Intergenic
1097191201 12:57220389-57220411 AGGCGCGGGGCGGGGGGCGGGGG + Intronic
1097284639 12:57868077-57868099 CGTGGACGGGCCGGGCACGGAGG - Intergenic
1098425944 12:70366174-70366196 CGCCCCCGGGCGGGGCGGGGCGG + Intergenic
1098991181 12:77065848-77065870 CGGCGCGGGGCGGCGCGGGGCGG + Intergenic
1099747616 12:86725748-86725770 GGGCGCTGGGCCGGGCGCGGTGG - Intronic
1100146331 12:91681976-91681998 CGGGGCGGGGCGGGGCGGGGTGG - Intergenic
1100267251 12:92989568-92989590 AGGCTCAGGGCTGGGCACGGTGG + Intergenic
1100565636 12:95790940-95790962 GGGCGTCGGTCGGGGCGCGGGGG - Intronic
1101597055 12:106177219-106177241 GGGAGACAGGCGGGGCACGGTGG - Intergenic
1101647566 12:106645346-106645368 CGGGCGAGGGCGGGGCACGGAGG - Intronic
1101772049 12:107760912-107760934 CGGAGCGGGGCGGGGCGCGGCGG - Intronic
1101934980 12:109050006-109050028 ATATGCCGGGCGGGGCACGGTGG + Intronic
1101973302 12:109332868-109332890 CTGCACCAGGCTGGGCACGGTGG - Intergenic
1102025838 12:109714013-109714035 TGGCCCCGGGCGGCGCGCGGGGG - Intergenic
1102046919 12:109835153-109835175 TGGCTCTGGGCCGGGCACGGCGG - Intergenic
1102520707 12:113476307-113476329 CGGCGGCGGGCGGTGCTCTGCGG - Intergenic
1102933579 12:116879829-116879851 CGGCGCGCGGCGGGGCTCGGGGG + Intronic
1103078487 12:118004554-118004576 CGGAGATGGGCTGGGCACGGTGG - Intergenic
1103320001 12:120086961-120086983 CGGCGCAGCGCCGGGCATGGTGG - Intronic
1103481953 12:121256087-121256109 CGGCAGGGGGCTGGGCACGGTGG + Intronic
1103698495 12:122835441-122835463 CGGGCCCGGGCGCGGCGCGGTGG + Exonic
1103851580 12:123937032-123937054 CAGCGCGGGGTGGGGCACGGCGG + Exonic
1103964679 12:124631284-124631306 GGGCAACCGGCGGGGCACGGTGG + Intergenic
1104439924 12:128786292-128786314 GGGCTCCTGGCTGGGCACGGTGG + Intergenic
1104568300 12:129903959-129903981 CGGGGCCGGGCGGGCCGAGGCGG - Intergenic
1104574978 12:129958447-129958469 AGGAGCCAGGCTGGGCACGGTGG - Intergenic
1104690115 12:130819158-130819180 CGGGGCAGGGCTGGGCACGGCGG - Intronic
1104734989 12:131131150-131131172 TGGGGCTGGGCGGGGCACTGAGG - Intronic
1105033829 12:132904109-132904131 CGGCGCATGGCGGGGCACAGCGG + Intronic
1105453531 13:20520816-20520838 TGGACCCGGGCCGGGCACGGTGG + Intronic
1105472088 13:20703777-20703799 CGGCGCCGGGCTGGGCCCCGGGG + Intronic
1105540797 13:21314750-21314772 CAGCCACGGGCTGGGCACGGTGG + Intergenic
1105900439 13:24747645-24747667 AGGCGCACGGCGGGGCACGGCGG + Intergenic
1105964480 13:25372168-25372190 CGGCCCCGGGCGAGAGACGGAGG - Exonic
1106117872 13:26832561-26832583 TGGCTCCGGGCCGGGCGCGGTGG - Intergenic
1106157463 13:27171674-27171696 CGGCGGCGGGCGGGGGAGGAGGG + Exonic
1106250486 13:27978541-27978563 CGGGGCGGGGCGGGGCAGGGGGG - Intronic
1106250494 13:27978551-27978573 TGGGGCCGGGCGGGGCGGGGCGG - Intronic
1106512349 13:30422291-30422313 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1106579223 13:31003297-31003319 GGGCACCGGGCCGGGCATGGTGG + Intergenic
1106720000 13:32427539-32427561 TGGCCCCAGGCGGGGCACGGCGG + Intronic
1107086558 13:36432393-36432415 CCGGGCCGGGCGGGGCAGGGCGG - Exonic
1111396227 13:87672428-87672450 CGGAGCCGGGCGGGGCGGGGAGG - Intergenic
1111672285 13:91347465-91347487 CGGCGGTGGGCGGGCCACGGGGG + Intergenic
1111879554 13:93938814-93938836 AGGTGCAGGGCTGGGCACGGTGG + Intronic
1112621912 13:101061913-101061935 CGGGGCAGGGCGGGGCGGGGCGG + Intronic
1113913303 13:113854949-113854971 CGGGGCTGGGGTGGGCACGGAGG - Intronic
1113969753 13:114179936-114179958 GGATGCCGGGCCGGGCACGGTGG - Intergenic
1113981821 13:114282390-114282412 AGGCGCCGGGCGGGCAACGCTGG - Intronic
1113989910 13:114353119-114353141 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1114479638 14:23024694-23024716 AGGAGCTGGGCGGGGCACAGTGG - Intronic
1114769109 14:25408567-25408589 CAGTGGCGGGCCGGGCACGGTGG - Intergenic
1115610654 14:35046225-35046247 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1116018357 14:39432566-39432588 CGGGGCGGGGCGGGGCTGGGCGG + Intergenic
1116018363 14:39432576-39432598 CGGGGCTGGGCGGGGCGGGGCGG + Intergenic
1116018371 14:39432591-39432613 CGGGGCGGGGCGGGGCTGGGCGG + Intergenic
1117548020 14:56809039-56809061 CGGGGCCGGGCGGGGGCCGAGGG - Intronic
1117963961 14:61188506-61188528 CGGAGCCGGGAGGCGCCCGGAGG - Intronic
1118032567 14:61832723-61832745 CTGGGCTGGGCCGGGCACGGTGG - Intergenic
1118413063 14:65502510-65502532 TGGACCCGGGCCGGGCACGGTGG - Intronic
1118841921 14:69519872-69519894 GGGCGCCTGGCCGCGCACGGTGG + Intronic
1118887514 14:69879354-69879376 AGGGGCGGGGCGGAGCACGGCGG - Intronic
1119202669 14:72769392-72769414 CAGCACTGGGCCGGGCACGGTGG + Intronic
1119211906 14:72838204-72838226 CAGCACCAGGCCGGGCACGGTGG + Intronic
1119236841 14:73026889-73026911 CCGCGGCGGGCAGGGCAGGGCGG - Intronic
1119392821 14:74302783-74302805 GGGCGGCGGACGAGGCACGGAGG + Intronic
1120953358 14:90061723-90061745 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1120953361 14:90061728-90061750 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1121042144 14:90758331-90758353 CGGGGCGGGGCGGGGCGCGGCGG + Intronic
1121168928 14:91836620-91836642 CGAGGCAGGGCGGGGCAGGGCGG + Intronic
1121262870 14:92579213-92579235 TGGCTCAGGGCCGGGCACGGTGG - Intronic
1121329923 14:93043552-93043574 TGGGGCTGGGCGGGGCAGGGAGG - Intronic
1121342770 14:93115319-93115341 CGGAGCGGGGCGGGGCGCGGCGG + Intronic
1121595244 14:95157301-95157323 CGGCGCCGGGCGGCTCCGGGAGG - Intronic
1121616998 14:95319938-95319960 CGGGGCGGGGCGGGGCGGGGAGG + Intergenic
1121711002 14:96039288-96039310 CGGGGTGGGGCGGGGCTCGGCGG - Intergenic
1121711009 14:96039303-96039325 CGGGGGCGGGCGGGGCGGGGTGG - Exonic
1122131277 14:99605372-99605394 CGGGGCGGGGCGGGGCGGGGGGG + Intergenic
1122444941 14:101761567-101761589 CGGGGCGGGGCCGGGCGCGGGGG + Intergenic
1122543300 14:102509494-102509516 CGGCCGCGGGCGCGGCGCGGGGG + Intronic
1122543374 14:102509719-102509741 CGGCGGCGGGCGGCGGGCGGCGG + Exonic
1122779153 14:104136358-104136380 CTGCGCGGTGCGGGGCGCGGCGG + Intergenic
1122820477 14:104342235-104342257 CGGGGCGGGGCGGGGCGGGGAGG + Intergenic
1122901013 14:104782378-104782400 CGGGGCCATGCTGGGCACGGTGG - Intronic
1122985705 14:105210709-105210731 TGGCTCCTGGCGGGGCGCGGGGG - Intronic
1123004470 14:105314718-105314740 GGGCGCCGGGCGGGGCGGGGCGG + Exonic
1123025030 14:105420256-105420278 CGGGGGCGGGCGGGGCTCGGCGG + Intronic
1123493235 15:20799482-20799504 CACCGCGGGGCGGGGCAGGGCGG - Intergenic
1123549742 15:21368584-21368606 CACCGCGGGGCGGGGCAGGGCGG - Intergenic
1123964053 15:25438378-25438400 CGGCGGGGGGCGGGGAAGGGGGG + Intronic
1124207846 15:27738446-27738468 CAACGCCGGGCCGGGCGCGGTGG + Intergenic
1124922402 15:34039204-34039226 CGGAGCGGGGCGGGGCGGGGCGG + Intronic
1125301026 15:38253079-38253101 CGGCGGCCGGGGGGGCGCGGGGG - Exonic
1126163514 15:45634925-45634947 CGGCGCCGGGCGGGGCACGGCGG + Exonic
1126367723 15:47913153-47913175 AGGCTCTGGGCCGGGCACGGTGG + Intergenic
1126823676 15:52528939-52528961 CCGCGCGGGGCGGGGCGGGGCGG + Exonic
1126940386 15:53759713-53759735 CGGGGCGGGGCGGGGCGAGGCGG - Intronic
1127207295 15:56733733-56733755 CGGCGCGTGGCGGGGCGCGTGGG - Intronic
1128139254 15:65287002-65287024 CTGGGCCGGGCGGAGCGCGGCGG - Intronic
1128995005 15:72289320-72289342 AGGGGCCGGGCGGGGCGGGGTGG - Intronic
1129008142 15:72391714-72391736 TGGGGCTGGGCTGGGCACGGTGG - Intergenic
1129483345 15:75844189-75844211 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1129710790 15:77819395-77819417 CGGCGGCGAGCGCGGCAGGGAGG + Intronic
1129854040 15:78811544-78811566 CGGGGCCGGCCGGGGCGGGGCGG - Intronic
1129986364 15:79923111-79923133 GGGCGCCGGGCGGGGCTGGGCGG - Intronic
1130177289 15:81586822-81586844 CGGAGCCAGTCGGGGCACTGGGG + Intergenic
1130330282 15:82917085-82917107 GGGCTCTGGGCCGGGCACGGTGG - Intronic
1131085966 15:89575849-89575871 GGGCGCCGGGCCGGGCAGGTGGG - Exonic
1131155367 15:90072089-90072111 GGGAGCTGGGCTGGGCACGGTGG - Intronic
1131171908 15:90184888-90184910 CGGGGCTGGGCGGGGCTTGGCGG + Intronic
1131272407 15:90955240-90955262 CGTCGCCGCCCGGGGCGCGGCGG - Intronic
1131431718 15:92393794-92393816 CGGAGCCGGGCGCGGGGCGGGGG + Intergenic
1131827036 15:96330460-96330482 CGGCGCGGCGCGGGGCACGCGGG - Intronic
1132370605 15:101295240-101295262 CGGCGGGGCGCGGGGCACGCTGG - Exonic
1132453223 15:101979893-101979915 CGGCGCCGGGCTGGGGCGGGGGG - Intergenic
1202958073 15_KI270727v1_random:95802-95824 CACCGCGGGGCGGGGCAGGGCGG - Intergenic
1132453668 16:10731-10753 CGGCGCCGGCCTGGGGGCGGGGG + Intergenic
1132478505 16:154149-154171 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1132478508 16:154154-154176 CGGGGCGGGGCGGGGCGGGGAGG + Intronic
1132480622 16:164797-164819 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1132480625 16:164802-164824 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1132480642 16:164835-164857 CGGGGCCCGGCGGGGCGGGGCGG + Intronic
1132480650 16:164845-164867 CGGGGCGGGGCGGGGCGGGGAGG + Intronic
1132480700 16:164940-164962 GGGCGCGGGGCGGGGCGGGGCGG + Intronic
1132480703 16:164945-164967 CGGGGCGGGGCGGGGCGGGGTGG + Intronic
1132498858 16:275948-275970 CGGCGCGGGGCGGGGCCGGGCGG - Intronic
1132527659 16:425729-425751 CGGCGGATGGCGGGGGACGGGGG - Exonic
1132552888 16:560578-560600 CGGCGCGGGGCGGGGAGGGGCGG + Exonic
1132591580 16:728487-728509 CGTCGCCTGGCGGGGGAGGGCGG - Exonic
1132604540 16:788282-788304 CGGCGCCGGGCACGGCATCGGGG - Intronic
1132614344 16:832786-832808 CGGAGCGGGGCGGGGCGGGGTGG - Intergenic
1132641810 16:981588-981610 CGGCGCCGGGCGGGGCAGGCGGG + Intergenic
1132666026 16:1081705-1081727 CAGCTCTGGGCGGGGCAGGGTGG + Intergenic
1132683478 16:1153080-1153102 CGGCGGGGGGCGGGGCGGGGCGG - Intergenic
1132683813 16:1154051-1154073 CGGCGGGGGGCGGGGGGCGGGGG + Intronic
1132690699 16:1180669-1180691 CTGGGCAGGGCGGGGCAGGGAGG + Intronic
1132719774 16:1309874-1309896 CGGCGCGGGGCCCGGCTCGGCGG - Intronic
1132870615 16:2114199-2114221 CGGGGCTGGGCGTGGCGCGGAGG + Exonic
1132942284 16:2514190-2514212 CGGCGGCGGGAGGGACTCGGGGG + Intronic
1132947050 16:2537731-2537753 CGGGGCTGGGCGGGGCTGGGCGG - Intergenic
1133121563 16:3611704-3611726 CGGCGCCGGGCGCGGGCCCGCGG + Intergenic
1133188524 16:4116584-4116606 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1133349220 16:5090400-5090422 GGGCGCAGGGCAGGGCACCGAGG - Intronic
1133771516 16:8869210-8869232 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1134145715 16:11759823-11759845 AGGTCCCGGGCCGGGCACGGTGG + Intronic
1134521916 16:14922705-14922727 CGGGGCTGGGCGTGGCGCGGAGG - Intronic
1134709585 16:16321356-16321378 CGGGGCTGGGCGTGGCGCGGAGG - Intergenic
1134716799 16:16361385-16361407 CGGGGCTGGGCGTGGCGCGGAGG - Intergenic
1134824650 16:17274887-17274909 CAGAGCAGGGCCGGGCACGGTGG + Intronic
1134849796 16:17470603-17470625 CGGCGCGGGGCCGGGGCCGGGGG + Exonic
1134950017 16:18347289-18347311 CGGGGCTGGGCGTGGCGCGGAGG + Intergenic
1134957953 16:18390774-18390796 CGGGGCTGGGCGTGGCGCGGAGG + Intergenic
1136153020 16:28364637-28364659 CGGCGGCGGCCGGAGCAGGGTGG + Intergenic
1136161819 16:28424947-28424969 GTGGGCCGGGCTGGGCACGGTGG - Intergenic
1136201147 16:28690045-28690067 GTGGGCCGGGCTGGGCACGGTGG + Intronic
1136210063 16:28750636-28750658 CGGCGGCGGCCGGAGCAGGGTGG - Intergenic
1136217490 16:28804234-28804256 GTGGGCCGGGCTGGGCACGGTGG + Intergenic
1136400053 16:30011990-30012012 AGGCGCAGGGCCGGGCAGGGGGG - Intronic
1136452188 16:30359689-30359711 CTGGGCCGGGAGGGGCAGGGGGG - Intronic
1136923967 16:34354016-34354038 TGGAGCCCGGCCGGGCACGGTGG - Intergenic
1136980606 16:35057790-35057812 TGGAGCCCGGCCGGGCACGGTGG + Intergenic
1137300529 16:47144026-47144048 CGGCGCGGGGCGGGGCGGGGCGG - Intergenic
1137617709 16:49856984-49857006 CGGCGCCGGCTGGAGCGCGGAGG - Intronic
1137926665 16:52547187-52547209 CGGCGCGGGGAGGGGACCGGCGG - Intronic
1138203334 16:55106134-55106156 GGGCTCCCGGCTGGGCACGGTGG - Intergenic
1138472059 16:57245505-57245527 CCGGGCCGGGCCGGGCAGGGTGG + Intronic
1138595107 16:58025679-58025701 CGGACCCGGGCGGGGACCGGGGG - Exonic
1138619077 16:58197719-58197741 CGCGGCCGGGCCGGGCATGGCGG + Exonic
1138660873 16:58516129-58516151 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1139388871 16:66592595-66592617 TGGAGCTGGGCTGGGCACGGTGG + Intergenic
1140223240 16:73058655-73058677 CGGCGGCTGGCGGGGGTCGGCGG + Intronic
1140927906 16:79600410-79600432 CGGCGCGGGCCTTGGCACGGGGG + Exonic
1141380281 16:83570020-83570042 TGGCTCCTGGCTGGGCACGGTGG - Intronic
1141531227 16:84648444-84648466 CGGGGCCGGGCGGCGCGGGGCGG - Intergenic
1141682272 16:85551557-85551579 AGGCTCACGGCGGGGCACGGTGG + Intergenic
1141694230 16:85612246-85612268 CGGGGCGGGGCGGGGCGGGGTGG + Intronic
1141741967 16:85899284-85899306 CGACGCCAGGCGGGGCGTGGGGG + Intronic
1142006106 16:87690259-87690281 CGGCGCCTGCCGGGGCTTGGGGG + Exonic
1142018643 16:87766134-87766156 CGGCCCCGGGCTGGGCGCGGTGG + Intergenic
1142052142 16:87965611-87965633 CGGGGCTGGGCGGGGCTGGGCGG + Intronic
1142159607 16:88550290-88550312 CTGCGCCGTGCTGGGGACGGGGG - Intergenic
1142267330 16:89070683-89070705 CGGCGGTGGGGGGGGCAAGGGGG - Intergenic
1142509419 17:385027-385049 CGGTGTCGGGCGGGGCGGGGCGG + Intronic
1142611050 17:1109360-1109382 CGGGGCCGGGCGGGACACGGAGG - Intronic
1142699140 17:1649089-1649111 AGGCGCTGGGCGGGGCTCCGGGG - Intronic
1142699157 17:1649130-1649152 AGGCGCTGGGCGGGGCTCCGGGG - Intronic
1142700514 17:1657356-1657378 CGTTGCTGGGCCGGGCACGGTGG + Intronic
1142762483 17:2050435-2050457 GAGCGCCGGGCGGGGCAGGGCGG - Intergenic
1142812604 17:2402138-2402160 CGGCGGTGGGCGGGGCGCGGGGG + Intergenic
1142876206 17:2853419-2853441 CGGGGCCGGGCCGGGGAGGGCGG + Intronic
1143029690 17:3961015-3961037 CGGTGCCAGGAGGAGCACGGTGG - Intronic
1143099883 17:4499123-4499145 CGGCGCCGGGGGGCGCAGCGAGG + Exonic
1143482945 17:7237969-7237991 CGGCCCCGGGAGCGGTACGGTGG - Intronic
1143582373 17:7834634-7834656 CGGGGCGGGGCGGGGCGCGGCGG + Intergenic
1144107306 17:11997512-11997534 CGGCACCGGGCGGAGCTAGGGGG + Intergenic
1145063140 17:19744790-19744812 CGGGGGCGCGCGGGGCGCGGCGG + Intronic
1146022599 17:29292822-29292844 CGGCCCCGGGCGGGTCCCTGGGG - Intronic
1146398577 17:32487072-32487094 CGGCGCTCGGCGGCGCTCGGGGG - Exonic
1146940834 17:36843311-36843333 TGGCTCCAGGCTGGGCACGGTGG + Intergenic
1147044472 17:37743084-37743106 CGGCGCGGGGCTGGGTGCGGAGG + Intronic
1147307410 17:39573646-39573668 CGGAGCCCGGCGCGGCCCGGCGG - Intergenic
1147382254 17:40062869-40062891 CGGAGCGGGGCGGGGGAGGGAGG + Exonic
1147679248 17:42229435-42229457 GGGCTCCTGGCCGGGCACGGTGG - Intronic
1148177864 17:45583505-45583527 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1148830171 17:50426107-50426129 CGGGGCGGGGCGGGGCGCGGCGG - Intergenic
1149461558 17:56833783-56833805 CCGCGCCGCGCGGGGCCCAGGGG - Exonic
1150070202 17:62143821-62143843 CTATGCAGGGCGGGGCACGGTGG + Intergenic
1150225561 17:63523007-63523029 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1150225564 17:63523012-63523034 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1150250065 17:63700169-63700191 GGGCGCGGGGCGGGGGCCGGCGG - Intronic
1150474020 17:65460671-65460693 TAGCCCCGGGCTGGGCACGGTGG + Intergenic
1150643456 17:66964587-66964609 CGGCGGCGGGGGAGGCGCGGAGG + Intergenic
1150676012 17:67245995-67246017 CCGGGCGGGGCGGGGCGCGGAGG + Intergenic
1150692778 17:67378940-67378962 GGGCGCCGGGCGCGGGGCGGGGG + Intronic
1151224867 17:72640576-72640598 GGGCGCCGGGCGTGGCGCCGGGG - Intergenic
1151407633 17:73899769-73899791 GGGAGCTGGGCGGGGCACGGTGG - Intergenic
1151660676 17:75516512-75516534 CGGCGGTGGGCGGGGCGTGGCGG + Exonic
1152394019 17:80020963-80020985 CTGGGCAGGGCCGGGCACGGTGG + Intronic
1152394410 17:80023700-80023722 CGGGGCCAGGCGGGCCACCGAGG - Intronic
1152468367 17:80477752-80477774 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1152552095 17:81035019-81035041 CAGCGCCGGGCGGGGGCGGGTGG + Intergenic
1152625659 17:81386941-81386963 CGGCCGGGGGCGGGGCGCGGCGG + Intergenic
1152637767 17:81437155-81437177 CGCAGCTGGGCGGGGCAGGGCGG - Intronic
1152703852 17:81833057-81833079 AGGTGCCGGGCGGGGAACGCGGG + Intronic
1152742106 17:82022931-82022953 GGGCGCGGGGCGGGGCTCCGGGG - Intronic
1152744179 17:82031588-82031610 CGGCGGGGGGCGGGGGGCGGGGG - Intergenic
1152760260 17:82103823-82103845 CGGGGCAGGGAGGGGCAGGGAGG + Intronic
1152783688 17:82237398-82237420 AGGCGCCGGGAGGGTCGCGGCGG - Exonic
1152918019 17:83051932-83051954 CGGCGCGGGGCGGGGCCGGGAGG + Intergenic
1153024039 18:657719-657741 GCGCGGCGGGCGGGGGACGGAGG - Exonic
1153263673 18:3247471-3247493 CGGCGAAGGGCGGGGCCCGTCGG - Intronic
1154160983 18:11981046-11981068 CGCTGCGGGACGGGGCACGGCGG + Intronic
1154241603 18:12658119-12658141 CGGCGCGAGGCGGGGCGGGGCGG - Exonic
1154299221 18:13178397-13178419 AGGTGCCGGGCAGGGCACGCAGG - Intergenic
1154450787 18:14474019-14474041 CACCGCGGGGCGGGGCAGGGCGG - Intergenic
1154957912 18:21277213-21277235 CTGGGCTGGGCCGGGCACGGTGG - Intronic
1155002871 18:21704172-21704194 TGACTCCGGGCAGGGCACGGTGG - Intronic
1155053204 18:22165649-22165671 CGGCCGCCGGCGGCGCACGGGGG + Intergenic
1155566481 18:27141069-27141091 CGAGCCTGGGCGGGGCACGGTGG + Intronic
1155654531 18:28177835-28177857 CGGCGCAGGGCGAGGACCGGCGG - Intergenic
1157700753 18:49760355-49760377 GGGCACCGGGCTGGGCATGGTGG + Intergenic
1157867142 18:51197072-51197094 CGGCGCAGGGCCAGGCCCGGCGG - Exonic
1158893480 18:61893923-61893945 CGGGGTCTGGCGGGGCACGGGGG - Intronic
1158931030 18:62325245-62325267 AGGTGCGGGGCGGGGCACGGGGG + Intergenic
1159586723 18:70289206-70289228 CGGCGCGGGCCGGGCCAGGGAGG + Intronic
1159670136 18:71212503-71212525 CGGCGGGGGGCGGGGCGGGGCGG + Intergenic
1159670165 18:71212552-71212574 CGGCGGGGGGCGGGGCGGGGCGG + Intergenic
1159670177 18:71212572-71212594 CGGCGGGGGGCGGGGCGGGGCGG + Intergenic
1159969163 18:74627839-74627861 CGGGGCGGGGCGGGGCGGGGTGG - Intronic
1160242063 18:77131849-77131871 CGGCTGCGGGCGGCGCACGTGGG + Intronic
1160453247 18:78979487-78979509 CGGCGGCCGGCCGGGCTCGGAGG - Intergenic
1160453447 18:78980165-78980187 CGGCGCGGGGCGCGGGGCGGCGG - Intergenic
1160633315 18:80262506-80262528 CGCCGCCGGGCGGGGACCGCGGG - Intergenic
1160788703 19:913059-913081 CGCGGGCGGGCGGGGCGCGGCGG - Intronic
1160841062 19:1147266-1147288 CCGCGCCGTGGGGGGCAGGGTGG - Intronic
1160853455 19:1205759-1205781 CGGCGCAGGGAGGGGGAGGGAGG + Intronic
1160904584 19:1446244-1446266 CGCCGAGGGGCGGGGCGCGGCGG + Intergenic
1160930543 19:1567870-1567892 CAGCGCCAGGCGGAGCGCGGCGG + Exonic
1160947795 19:1651802-1651824 CGGGGCCGGGCGGGCCGGGGGGG - Intronic
1160948123 19:1652672-1652694 GGCCGCCGGGCGGGGCACTCGGG - Intergenic
1160999865 19:1905230-1905252 CGGAGCGGGGCGGGGCGAGGCGG + Exonic
1161014921 19:1978763-1978785 CGGGGCGGGGCGGGGCTCGGAGG + Intronic
1161022171 19:2015634-2015656 CGGGGTCGGCCCGGGCACGGGGG - Exonic
1161029586 19:2051430-2051452 CTGCGCAGTGCGGCGCACGGGGG + Intergenic
1161153587 19:2721438-2721460 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1161153590 19:2721443-2721465 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1161153593 19:2721448-2721470 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1161175884 19:2841878-2841900 CGGCCCCGGGCGGGGCGTGGGGG - Intronic
1161194684 19:2979807-2979829 CGGGGGCGGGCGGGGGAGGGGGG + Intronic
1161304161 19:3557613-3557635 CTGCGCCGGGCGGGGCAGGGCGG + Intronic
1161319330 19:3633723-3633745 CTTGGCGGGGCGGGGCACGGCGG + Intronic
1161350003 19:3786183-3786205 GGGCGCGGGGCGCGGCTCGGGGG - Intronic
1161388144 19:4007803-4007825 CGGCGCCGGCCGGGGCAAGTGGG + Intronic
1161581731 19:5084850-5084872 GGGCGGCGGGCGGGGGAGGGTGG - Intronic
1161663934 19:5563625-5563647 CGGCACCCGGCCAGGCACGGTGG + Intergenic
1161802708 19:6424709-6424731 CGGGGCCGGGCCTGGCGCGGAGG + Exonic
1161851370 19:6739634-6739656 CGGGGCCGGGCGGGGCGGGGCGG + Intronic
1161925236 19:7294486-7294508 CGGGGCGGGGCGGGGCCGGGCGG - Intergenic
1162029114 19:7909823-7909845 CGGGGCCGGGCGGGGGGCGTGGG - Exonic
1162104113 19:8359719-8359741 TGGGGCCAGGCTGGGCACGGTGG - Intronic
1162312145 19:9913909-9913931 CGGAGCCCGGCGGGGGGCGGGGG + Intronic
1162421638 19:10568891-10568913 GGGCGCCGGGCAGGGCCCCGCGG - Exonic
1162471019 19:10871973-10871995 CGGCCCGGGGCGGGGGCCGGCGG + Intronic
1162486067 19:10961203-10961225 CGGCGCGGGGCCGGGGAGGGCGG + Intronic
1162911588 19:13850652-13850674 CGGCGTCCGGAGGGGCCCGGCGG + Intergenic
1162975876 19:14206741-14206763 GGGCGCCGGGCCGGGCCCGTGGG + Intergenic
1163368786 19:16890425-16890447 CAGCGCCAGGCTGGGCACGTAGG - Exonic
1163421316 19:17215232-17215254 GGGCGCTGGGCCGGGCGCGGTGG - Intergenic
1163424879 19:17235859-17235881 CGGCGCAGGGGGCGGCGCGGCGG - Exonic
1163442422 19:17328676-17328698 CGGCGGCGGGCGGGGGAAGGCGG - Exonic
1163631444 19:18419770-18419792 GGGCACCGCGCGGGGCACGTGGG + Intronic
1164208223 19:23075279-23075301 AGTCGCCGGGCGGGGGTCGGTGG - Intronic
1165311008 19:35029723-35029745 CGGAGAGGGGCGGGGCAGGGGGG + Intergenic
1165349359 19:35267990-35268012 CCGCGCGGGGCGGGGGACCGGGG + Intergenic
1165426411 19:35748331-35748353 CTGCGCCGCGCGGGGCACGGTGG - Intronic
1165707113 19:37984148-37984170 CTGCGCAGGGCGGGGCAGCGAGG + Intronic
1165832281 19:38735872-38735894 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1165832284 19:38735877-38735899 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1166079452 19:40434399-40434421 AGGGGGAGGGCGGGGCACGGTGG + Intergenic
1166215336 19:41331025-41331047 CGGGGCGGGGCGGGGCGGGGCGG + Exonic
1166310433 19:41959345-41959367 CGGCGTCGGGCGGGGCCGGCGGG - Exonic
1166564339 19:43754595-43754617 CGGCGGCGGGCGGGGCGCTCCGG - Intronic
1166731972 19:45064323-45064345 CGGCTGCAGGCGGGGCACGGAGG - Exonic
1166832203 19:45645476-45645498 CGGCGCCGGGCCCGGCGCTGGGG + Exonic
1166991909 19:46697701-46697723 CGGGGCGGGGCCGGGTACGGCGG - Intronic
1167072976 19:47231234-47231256 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1167074338 19:47239783-47239805 CAGCGGCGGGCGGGGCCTGGGGG - Intergenic
1167237788 19:48325534-48325556 AGGAGAAGGGCGGGGCACGGAGG + Exonic
1167251027 19:48398490-48398512 CGGGGCCGGGCGGGGCCGGTGGG + Exonic
1167258155 19:48443154-48443176 GGGCGGCGCGGGGGGCACGGGGG + Exonic
1167268253 19:48493889-48493911 CGGCGCCGGGCGCGGCGGCGGGG - Exonic
1167408415 19:49329918-49329940 CAAGGCCGGGCTGGGCACGGTGG - Intergenic
1167454541 19:49591476-49591498 AGGCCCCGGGCGGGGGAGGGAGG - Intergenic
1167463891 19:49640137-49640159 GGGAGCCGGGCGGGACCCGGGGG + Exonic
1167464305 19:49642192-49642214 CGGCGCGGGGCGGGGCGGGCTGG - Exonic
1167507103 19:49876613-49876635 CGGCGCCGGGCCGGCCATGCTGG - Exonic
1167577911 19:50326532-50326554 CGGCTCAGGACGCGGCACGGTGG + Intronic
1167775759 19:51553558-51553580 AGGAGCCGGGAGGGGCACAGAGG - Intergenic
1167990691 19:53358303-53358325 CGGGGCTGGGCTGGGCAGGGCGG - Intergenic
1168358683 19:55719438-55719460 AGGGGCCGGGCCGGGCATGGCGG - Intronic
1168459038 19:56538772-56538794 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1168459041 19:56538777-56538799 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1168459044 19:56538782-56538804 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1168459047 19:56538787-56538809 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1168459050 19:56538792-56538814 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1168459053 19:56538797-56538819 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1168459056 19:56538802-56538824 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1168459059 19:56538807-56538829 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1168459064 19:56538817-56538839 CGGGGCGGGGCGGGGCAGCGGGG + Intergenic
925008865 2:467388-467410 CAGCTCCGGGCGGGGCGGGGAGG - Intergenic
925034779 2:676980-677002 CGGGGCCGGGCGGGGCCTTGTGG - Intronic
925725246 2:6865505-6865527 CGCCGCCAGGCGGGGGTCGGGGG + Exonic
926077254 2:9951511-9951533 CGGCGCGGGGCGGGGGGCGGGGG - Intergenic
926095738 2:10079946-10079968 CGGCGCGGGGCGGGCTCCGGGGG + Exonic
926163495 2:10504049-10504071 CGCCACAGGGCCGGGCACGGTGG + Intergenic
926250996 2:11155398-11155420 CGGGGCCTGGCGGCGCGCGGAGG + Exonic
927125966 2:20012614-20012636 GGGGGCCGGGCGCGGCATGGTGG + Exonic
927225076 2:20756320-20756342 AGGCACCAGGCTGGGCACGGTGG - Intronic
927606486 2:24491199-24491221 CGGGGCGGGGCGGGGCGCGAAGG + Intergenic
927638856 2:24834418-24834440 TGGTGCCGGGCGGGGGGCGGGGG - Intronic
927881444 2:26692663-26692685 CGGGGCCGGGCGGAGGAGGGCGG + Intergenic
927938148 2:27086722-27086744 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
927938151 2:27086727-27086749 CGGGGCGGGGCGGGGCGGGGCGG + Exonic
928158049 2:28894626-28894648 CGGCGCGGGGCGGAGCCTGGAGG - Exonic
928546642 2:32334948-32334970 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
928546645 2:32334953-32334975 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
928546650 2:32334958-32334980 CGGGGCGGGGCGGGGCGGGGGGG + Intergenic
928550364 2:32364526-32364548 CTGAGCAGGGCTGGGCACGGTGG - Intronic
929779803 2:44950098-44950120 CTGTGCCGGGCGGGGCTCGGCGG + Intergenic
930730655 2:54724835-54724857 CGGCGCCCGGCGGGGTCTGGCGG + Exonic
931253930 2:60554446-60554468 CGGCGCAGGCCGGGGCCCGAGGG + Intergenic
931681166 2:64750991-64751013 CGGGGACGGGCGGGGTAAGGGGG + Intronic
932152672 2:69387256-69387278 CGCCGAGGGGCGGGGCCCGGCGG - Intergenic
932178306 2:69622311-69622333 CACCGCCGGGCGGGGGAGGGGGG - Intronic
932567146 2:72917431-72917453 CGGGGCGGGGCGAGGGACGGCGG - Intronic
932779180 2:74549334-74549356 GGGCGCCGGGCGGAGCAGGCCGG - Intronic
934045511 2:88170255-88170277 GGGCGGGGGGCGGGGGACGGAGG - Intergenic
934296881 2:91749199-91749221 CGGCCCGGGGCGAGGCACGCAGG + Intergenic
934304510 2:91810107-91810129 CGGCACCGGGCGCGGTGCGGGGG - Intergenic
934328747 2:92042643-92042665 CGGCACCGGGCGCGGTGCGGGGG + Intergenic
934549346 2:95245554-95245576 CAGCTCCAGGCTGGGCACGGTGG - Intronic
935896117 2:107739248-107739270 TGGCTCCGGGCAGGGCACAGTGG - Intergenic
936122695 2:109760427-109760449 CGGCGCAGGGCCGGGGGCGGCGG + Intergenic
936221998 2:110611046-110611068 CGGCGCAGGGCCGGGGGCGGTGG - Intergenic
936512116 2:113157204-113157226 CGGCGCCGTGCGGGGCGCGCAGG + Intergenic
936512155 2:113157326-113157348 CGGCGCAGGGCGGGGAGGGGCGG - Intronic
936569893 2:113603972-113603994 CGCCGCCGGGCGGGGAGCGCGGG + Intergenic
937018938 2:118633082-118633104 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
937853730 2:126657718-126657740 CTGGGCTGGGCTGGGCACGGGGG - Intronic
938673053 2:133603510-133603532 TGATGCCGGGCTGGGCACGGTGG - Intergenic
939375453 2:141359753-141359775 CGGGGCGGGGCGGGGCGCGGGGG - Intronic
939629583 2:144516656-144516678 CGGCCCCGCGCGGGGTCCGGTGG - Intronic
940316703 2:152335099-152335121 CGGAGCCGGGCCGGGGGCGGGGG + Intergenic
940317012 2:152336214-152336236 CCGCGCCGGGCGGTGAGCGGAGG + Intronic
940774938 2:157875870-157875892 CGGCGCGGGGCGGCGCGGGGCGG + Intergenic
940774944 2:157875880-157875902 CGGCGCGGGGCGGGGCGGGGCGG + Intergenic
940901141 2:159127699-159127721 CGGGGCCCGTCAGGGCACGGGGG + Intronic
941646705 2:168048497-168048519 CCGGGCCGGGCCGGGCGCGGTGG - Intronic
941901862 2:170686400-170686422 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
941905858 2:170715945-170715967 CGGAGCCGGGAGGGGCCCGTCGG + Intronic
942019177 2:171849841-171849863 CGCCACTGGGCCGGGCACGGTGG - Intronic
942084102 2:172428129-172428151 CCGCGCGGGGCGGGTCAGGGCGG - Intronic
944615111 2:201451804-201451826 CGGCGCGGGGCGCGGGAGGGCGG - Exonic
945833130 2:214809716-214809738 CGGGGAGGGGCGGGGCACGGCGG + Intergenic
946327670 2:218993144-218993166 GGGCGCCGGGCCCGGCGCGGGGG + Exonic
946692277 2:222319040-222319062 CTGCGGCGGGCGGCGCGCGGAGG - Intergenic
947147807 2:227084842-227084864 CCTCTCCGGGCTGGGCACGGTGG + Intronic
947623467 2:231605018-231605040 CGGGCCCGGGCGGGGCGGGGCGG + Intergenic
947742934 2:232493104-232493126 AGGCTCCGGGCTGGGCACTGGGG - Intergenic
947992404 2:234497453-234497475 GGGCGCGAGGCGGGGCAGGGCGG + Intergenic
948115876 2:235494140-235494162 GGTCGGCGGGCGGCGCACGGCGG + Exonic
948140498 2:235669579-235669601 CGGGGCGGGGCGGGCGACGGGGG - Intronic
948142442 2:235683850-235683872 TGGGGCCGGGCGGGGGACGGGGG - Intronic
948801508 2:240435534-240435556 CGGGGCGGGGCGCGGCGCGGGGG - Intergenic
948824671 2:240568451-240568473 CGGCGCGGGGCCGGGCCGGGCGG + Intronic
948983832 2:241508365-241508387 GGGCCCGGGGCGGGGCTCGGTGG - Intronic
949088871 2:242182369-242182391 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1168777839 20:462548-462570 CGGCGCGGGGCGGGGCCAGCGGG - Exonic
1170423203 20:16212923-16212945 CTGCTCTGGGCGGGGCACAGTGG + Intergenic
1170889804 20:20367873-20367895 CGGCGCCGGGCGGGGCGACCAGG + Intergenic
1170924775 20:20712668-20712690 CGGCGAGGGGCGGGGCAGGAAGG + Intergenic
1172890542 20:38260791-38260813 CGGGGCGGGGCGGGGCGCGGCGG + Intronic
1173847087 20:46195015-46195037 CAGCTCCTGGCTGGGCACGGTGG - Intronic
1174517098 20:51101053-51101075 AGGCTCCAGGCTGGGCACGGTGG + Intergenic
1174649324 20:52111102-52111124 AGACGCGGAGCGGGGCACGGCGG + Intronic
1175267078 20:57709594-57709616 CGGCGCGGCGCGGGGCGCGGGGG + Exonic
1175404380 20:58717119-58717141 CGGCGTCGGGGGGCCCACGGGGG + Intronic
1175859555 20:62143116-62143138 CGGGGCCGGGCGCGGCGCTGTGG - Intronic
1175869027 20:62198710-62198732 CCGCGCTGGGCGGGGCAGGAGGG + Exonic
1175926543 20:62474233-62474255 CGGCGCCGGGCCGGGCCTGGAGG - Intronic
1175927115 20:62476303-62476325 CGGCGGGGGCCGGGGCAGGGAGG - Intergenic
1175992389 20:62796331-62796353 CCGCGCGGGGCGGAGCAGGGCGG + Intergenic
1176029985 20:63007126-63007148 CGGCGCGGGGCGGCGCGGGGCGG + Intergenic
1176056536 20:63151847-63151869 GGGAGCCGGGTGGGGCCCGGGGG + Intergenic
1176148087 20:63574284-63574306 CGGGGCAGGGCGGGGCGGGGCGG - Intergenic
1176194395 20:63830826-63830848 CGGCGCGGGGCGGGGCGCGCGGG - Intronic
1176201549 20:63863042-63863064 CGACGCGGGGCGGGGCGGGGGGG + Exonic
1176232277 20:64038564-64038586 CCGGGCCGGGCCGGGCGCGGGGG + Intronic
1176242134 20:64080042-64080064 GAGCGCGGGGCGGGGCGCGGCGG - Intergenic
1176243007 20:64083746-64083768 CGGAGCCGGCCGGGGCGGGGCGG - Intronic
1176283409 20:64328086-64328108 CGGCGCCGGCGGGGGGAGGGAGG - Intergenic
1178104070 21:29299080-29299102 CTGGGCTGGGCGGGGCGCGGGGG + Intronic
1178334641 21:31732194-31732216 CGGCGCAGGGCGGGACGAGGCGG - Intergenic
1178334644 21:31732204-31732226 CGGTGCAGGGCGGCGCAGGGCGG - Intergenic
1178707591 21:34888610-34888632 CGGCGCAGGGCCGGGCAGCGTGG + Intronic
1178948432 21:36966742-36966764 CGGCGCGGGGGTGGGGACGGCGG + Intronic
1178992286 21:37366404-37366426 GGGCGCGGGGCGGGGCGGGGCGG + Intronic
1179375438 21:40846708-40846730 CCGGGCCGGGCGGAGCGCGGGGG - Exonic
1179428745 21:41304225-41304247 GGGCGCCTGGCTGGGCTCGGCGG + Intronic
1179570067 21:42273443-42273465 CGGAGTGGGGCGGGGCAGGGCGG - Intronic
1179626895 21:42653934-42653956 CGGGGCCGGGCGCGGCGGGGCGG + Intronic
1179785142 21:43725520-43725542 CAGCGCTGGGCCAGGCACGGTGG + Intronic
1179810118 21:43865024-43865046 CGGCGCGGGGGGGGACGCGGAGG - Intergenic
1180264094 21:46698651-46698673 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1180637904 22:17275500-17275522 CGGGGCGGGGCGGGGCGGGGAGG - Intergenic
1180649982 22:17369597-17369619 GGGCGCCGGGCGGGGGGCGGCGG - Exonic
1180837311 22:18936337-18936359 CGGGGCGGGGCGGGGCGGGGCGG - Exonic
1180837314 22:18936342-18936364 CGGGGCGGGGCGGGGCGGGGCGG - Exonic
1180837317 22:18936347-18936369 CGGGGCGGGGCGGGGCGGGGCGG - Exonic
1180920970 22:19521518-19521540 AGGCACGGGGCTGGGCACGGTGG - Intergenic
1180960583 22:19760685-19760707 GGGCCCCGGGCGGGGCGGGGCGG + Intronic
1181014908 22:20063282-20063304 CGGCTGCGGGCGGGCCACAGAGG + Intronic
1181068818 22:20320144-20320166 CGGCGGGGCGCGGGGCAGGGCGG - Intergenic
1181478026 22:23180576-23180598 CGGCGGCGGCGGCGGCACGGCGG + Exonic
1181478099 22:23180842-23180864 CGCCGCCGCGCGGGCCATGGGGG + Exonic
1181791365 22:25269547-25269569 CAGCCCAGGGCTGGGCACGGTGG - Intergenic
1181831612 22:25564797-25564819 GGGCGCCGGGCGGCGCGCGAGGG + Intergenic
1181978597 22:26750494-26750516 CTGAGCCAGGCTGGGCACGGTGG - Intergenic
1182358202 22:29732068-29732090 GTGCCCCGGGCTGGGCACGGAGG - Intronic
1182510306 22:30814992-30815014 CTGGGCTGGGCCGGGCACGGTGG + Intronic
1182586339 22:31346148-31346170 CGGCGGCGGGGCGCGCACGGGGG + Exonic
1183262127 22:36802313-36802335 TGGCACTGGGCTGGGCACGGTGG + Intronic
1183407878 22:37639434-37639456 CGGGGCTGGGCGGGGCGCTGCGG + Intronic
1183441393 22:37825022-37825044 CGGCGGCGGCCGAGGCGCGGCGG + Exonic
1183456344 22:37925252-37925274 CAGCACTGGGCGGGGCACTGGGG - Intronic
1183524938 22:38317302-38317324 CGGGGCCGAGCGGAGCGCGGCGG - Exonic
1183528124 22:38336274-38336296 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1183720180 22:39557888-39557910 GGGCGGCGGGCGGGGGGCGGCGG - Intergenic
1183893701 22:40951153-40951175 CGGGGCCGGGCGGGGCCGGGCGG - Intergenic
1184164786 22:42720809-42720831 CGGCGGCGGGCGGCGGACAGCGG + Intronic
1184276552 22:43412166-43412188 CGGAGGCGGGCGGGGCGCGGCGG + Intronic
1184285530 22:43468974-43468996 CACCCCCGGGCTGGGCACGGTGG - Intronic
1184558517 22:45247255-45247277 CGTCTCTGGGCTGGGCACGGTGG + Intergenic
1184963359 22:47948114-47948136 AGGCGCAGGGCTGGGCGCGGTGG - Intergenic
1185037921 22:48489433-48489455 GGGCGCGGCGCGGGGCGCGGTGG + Intergenic
1185258537 22:49849373-49849395 AGGCGCGGGGCGGGACAGGGTGG + Intergenic
1185259505 22:49853801-49853823 CGGCGCGGGGCGGGGCTGGCCGG - Intergenic
1185272391 22:49935333-49935355 GGGCGCGGGGTGGGGCGCGGGGG + Intergenic
1185299915 22:50074185-50074207 CGGCGGCGGGCGGGCCAGAGGGG + Intronic
1185335137 22:50267971-50267993 CGGCGCCGGGAGGGGTCCGAGGG + Intronic
1185430332 22:50807032-50807054 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1203287404 22_KI270734v1_random:161636-161658 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1203287407 22_KI270734v1_random:161641-161663 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1203287410 22_KI270734v1_random:161646-161668 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
949272771 3:2239010-2239032 CAGAGCCAGGCCGGGCACGGTGG - Exonic
949552405 3:5122257-5122279 CGGCGCCGGGACGGGCGTGGGGG + Exonic
950289675 3:11773506-11773528 CGGGGTGGGGCTGGGCACGGTGG - Intergenic
950400947 3:12768887-12768909 CGGGGCGGGGCGGGGCAGGGCGG + Intronic
950586420 3:13895520-13895542 TGGGGCCGAGCGGGGCAGGGTGG + Intergenic
951078495 3:18425078-18425100 CGGAGCCGAGCGGGGCACGGCGG - Intronic
953172999 3:40524796-40524818 CGGCGGCGGGCGTGGAACTGTGG - Intergenic
953485001 3:43286689-43286711 CGGAGCGCGGCGGGGCGCGGCGG + Intronic
953705372 3:45226338-45226360 CGGGGCGGGGCGGGGCACGCGGG - Intergenic
953924731 3:46976886-46976908 CGGGGCGGGGCGGGGCAAGGCGG - Intronic
954025720 3:47781758-47781780 CGGCGGCGGGCCGGGGACAGCGG - Exonic
954170831 3:48800958-48800980 CCGTGCCTGGCTGGGCACGGTGG - Intronic
954268943 3:49492210-49492232 TGGAGCCAGGCGGGGTACGGTGG - Intronic
954277854 3:49554304-49554326 AGGAGCCGGGCGGGGGCCGGCGG - Intergenic
954346093 3:50000704-50000726 CTGGGCCTGGCTGGGCACGGTGG - Intronic
954382511 3:50227237-50227259 GGGCCCCGCGCGGGGCAAGGGGG + Intronic
954615533 3:51967296-51967318 GCGGGCCGGGCGGGGCACGGCGG - Intronic
954615556 3:51967347-51967369 CGGCGGCGGCGGCGGCACGGCGG + Exonic
954717463 3:52533740-52533762 GGGCGGCGGGCGGCGCGCGGTGG - Exonic
954717543 3:52533932-52533954 CGGGGCGGGGCGGGGCGGGGAGG + Intronic
954723120 3:52582808-52582830 AGACACCGGGCCGGGCACGGTGG + Intronic
954733467 3:52685591-52685613 CGGGGTTGGGCGGGGCGCGGCGG - Intronic
954794927 3:53156627-53156649 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
954812374 3:53256049-53256071 AGTCGCCGGGCGGGGCGGGGCGG + Intronic
954838915 3:53494565-53494587 GGGCGGAGGGCGGGGGACGGCGG + Intergenic
956675066 3:71725431-71725453 CGGGGCGGGGCGGGGGCCGGGGG - Intronic
956675081 3:71725455-71725477 CGGGGCGGGGCGGGGCGCGCGGG - Intronic
956798801 3:72738889-72738911 CGTCGCGGGGCGGGGCGGGGTGG - Intergenic
956982129 3:74651249-74651271 CAGCATCGGGCCGGGCACGGTGG - Intergenic
958638540 3:96776879-96776901 CGGCGGCGGGCGCGGCCCGCGGG - Intergenic
958692141 3:97481668-97481690 CGGTGCGGGGCGGGGCCGGGCGG - Intronic
958719111 3:97822597-97822619 CGGAGCCAGGCGGGGATCGGGGG - Intronic
960223774 3:115146998-115147020 CGGGGCGGGGCGGGGCGCGGGGG + Intronic
960625357 3:119677008-119677030 CGGGGCGGGGCGGGGCGGGGGGG + Intronic
961067055 3:123884360-123884382 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
961612571 3:128152902-128152924 CGGCGGGGGGCGGGGGAGGGCGG - Intronic
961659032 3:128458622-128458644 CAGAGCCGGGCGGGGCAGTGAGG - Intergenic
961688242 3:128650406-128650428 GGGCGGCGGGCGGGGCACAGGGG - Intronic
961762822 3:129184053-129184075 AGGCCGCGCGCGGGGCACGGCGG - Intergenic
961770267 3:129244443-129244465 TGGAGACGGGCCGGGCACGGTGG - Intergenic
961821619 3:129578289-129578311 CAGCGCCGGGTGGGGCCAGGAGG - Intronic
962222297 3:133573989-133574011 CGGCGGCGGGCGCGGCCCGCGGG - Exonic
962804253 3:138915718-138915740 CAGCGCAGGGCGGGGCAGGAAGG + Intergenic
963081988 3:141402681-141402703 CGGAGCGGGGCGGGGCGGGGTGG + Intronic
963091403 3:141486936-141486958 CCGCGGCGGGCGGGGCGGGGCGG + Intergenic
963241172 3:143003975-143003997 GGAAGCAGGGCGGGGCACGGTGG - Intronic
963755439 3:149231012-149231034 AGGTGCTGGGCTGGGCACGGTGG + Intergenic
964129778 3:153273608-153273630 CGGCCCAAGGCCGGGCACGGTGG + Intergenic
964421820 3:156511388-156511410 AGATGACGGGCGGGGCACGGTGG - Intronic
965558139 3:170038082-170038104 CGGGGCGGGGCGGGGCGGGGCGG + Exonic
966696258 3:182793444-182793466 GGGGGCCGGGCGGGGCGGGGCGG + Intergenic
966808755 3:183825623-183825645 CGGCGCGGGGCGGGCCGCGGGGG - Intergenic
966868578 3:184276069-184276091 CGGGGCCGGGCAGGGGACCGGGG + Intronic
966886425 3:184380118-184380140 CGGCGCCGGGCCGGGCGGGGCGG - Exonic
967054961 3:185823786-185823808 GGGCGCCGGCCGGGGCCCGGGGG + Intronic
967352422 3:188528312-188528334 CGGGGAGGGGCAGGGCACGGTGG - Intronic
967984280 3:195083736-195083758 CTGCGCCTGGCGGTGCACAGTGG + Intronic
968054175 3:195678535-195678557 CAGCGACGGTCAGGGCACGGAGG - Intergenic
968078070 3:195827419-195827441 CCGCGTCAGGCCGGGCACGGTGG - Intergenic
968090215 3:195894674-195894696 CCGGGCCGGGCCGGGCGCGGTGG - Intronic
968101716 3:195970607-195970629 CAGCGACGGTCAGGGCACGGCGG + Intergenic
968199553 3:196740255-196740277 CGGCCCCGCGCGGGGCAGGTCGG - Intronic
968514219 4:1009656-1009678 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
968514222 4:1009661-1009683 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
968514787 4:1011527-1011549 GGCGGCGGGGCGGGGCACGGGGG + Intronic
968699270 4:2047061-2047083 CGGCGCGGGTCTGGCCACGGTGG - Intergenic
968815132 4:2818128-2818150 CGGGGCCGGGAGGGGCGCGCCGG + Intronic
968879889 4:3293300-3293322 CGGCGCGGGGCGGGGCGGGGCGG + Intronic
968981526 4:3852569-3852591 CGGGGCGGGGCGGGGCGGGGTGG - Intergenic
968981529 4:3852574-3852596 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
968981532 4:3852579-3852601 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
968996338 4:3948058-3948080 GGGCGCAGGGCAGGGCACCGAGG - Intergenic
969138788 4:5051616-5051638 CAGCCCGAGGCGGGGCACGGCGG + Exonic
969153196 4:5187608-5187630 AGGGGCCGGGCGGGGGAGGGGGG + Intronic
969379414 4:6783678-6783700 TGGCGCGGGGCGCGGCGCGGGGG + Intronic
969577540 4:8045361-8045383 TGGGGCTGGGCCGGGCACGGCGG + Intronic
969655734 4:8497356-8497378 CTGCTCTGGGCCGGGCACGGTGG + Intergenic
969698921 4:8755007-8755029 GAGCGCAGGGCCGGGCACGGTGG + Intergenic
969720291 4:8889761-8889783 AGGGGCGGGGCGGGGCGCGGTGG + Intergenic
969926852 4:10593365-10593387 GGACTCCAGGCGGGGCACGGTGG + Intronic
970333129 4:15004157-15004179 CGGCGGCGGAGGGGGCACAGCGG - Exonic
970456210 4:16226523-16226545 CGGCGAGGGGCGGGGCGAGGCGG - Exonic
972225382 4:37005679-37005701 CTGCCCCGGGCCGGGCGCGGTGG + Intergenic
972632877 4:40857186-40857208 CCGCGGCGGGCGGGGCAGGGAGG - Intronic
973317697 4:48779534-48779556 CGGCGGCTGGCGGGCCCCGGCGG - Intronic
974003125 4:56530556-56530578 CGGGGCGGGGCTGGGCGCGGGGG + Intergenic
976175157 4:82344259-82344281 CGGAGGCCGGCCGGGCACGGTGG - Intergenic
976751978 4:88457852-88457874 ATGCGGCGGGCGGGGGACGGGGG - Intronic
977536547 4:98261352-98261374 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
977536553 4:98261362-98261384 CGGCGGGGGGCGGGGCGGGGCGG - Intronic
978490052 4:109302760-109302782 GGGCGCCGGGAGGGGGTCGGGGG - Intergenic
978778340 4:112524057-112524079 CGCCCCCTGGTGGGGCACGGAGG + Intergenic
982157209 4:152535265-152535287 CGGGGCCGGGGGGGACCCGGGGG - Exonic
982257640 4:153466266-153466288 CGGCGCGGGGCGGGGCGGGGCGG + Intergenic
982257643 4:153466271-153466293 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
982257646 4:153466276-153466298 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
982257649 4:153466281-153466303 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
982257652 4:153466286-153466308 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
982806677 4:159773732-159773754 TGGCGTGGGGCCGGGCACGGTGG - Intergenic
983814359 4:172104228-172104250 CTGCCCCAGGCCGGGCACGGTGG - Intronic
984002598 4:174268721-174268743 CGGCCCCCGGCCGGGCGCGGTGG - Intronic
984801769 4:183722830-183722852 CGGCGCGGGGCGGGGCGTCGGGG + Intergenic
985113807 4:186571970-186571992 TGGGGCGGGGCGGGGCAGGGCGG + Intergenic
985282192 4:188298589-188298611 AGCAGCCGGGCCGGGCACGGTGG - Intergenic
985466700 4:190203576-190203598 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
985629950 5:1009030-1009052 CGGGGCCCGGCGGGGCGTGGCGG + Exonic
985629985 5:1009165-1009187 CGGCGGCGGCTGCGGCACGGCGG - Exonic
985660898 5:1156008-1156030 CGGCGCGGGGAGGGGCCGGGAGG + Intergenic
985708368 5:1414439-1414461 GGGGGCCGGGAGGGGCAGGGCGG + Intronic
985784460 5:1886703-1886725 CGGCGCGGGGCGGGGGGTGGGGG - Intronic
986813689 5:11385284-11385306 CGGGGCCGGGCTGGGCCGGGTGG - Intronic
986847996 5:11778299-11778321 CAGAGCTGGGCGGGGCAGGGGGG + Intronic
987099840 5:14581966-14581988 TGGGGCCGGGCGGGGCGGGGCGG + Intronic
987374027 5:17217867-17217889 CGGGGCGGGGCGCGGCGCGGTGG - Intronic
987374230 5:17218590-17218612 CGGCCCCGGCCCGGGCCCGGGGG + Intronic
988369278 5:30346009-30346031 GGGGGCCGGGGGGGGCGCGGGGG - Intergenic
988577773 5:32444040-32444062 CCGGGCCGGGCCGGGCAAGGCGG + Intronic
988577787 5:32444060-32444082 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
989575389 5:42983025-42983047 CAGAGCTGGGCGGGGCACGGTGG - Intergenic
991216891 5:64165970-64165992 CGGAGTCGGGCGGGGCGCGGCGG + Intronic
991351220 5:65722185-65722207 CGGCGCGGGGCGGGGCTGGTAGG + Exonic
992067297 5:73120167-73120189 CGGCGGCGTGGGGGGCGCGGAGG - Intergenic
992080592 5:73232399-73232421 CGGCCCGGGGCTGGGCAGGGAGG - Intergenic
992832414 5:80606913-80606935 TGGTGCCTGGCTGGGCACGGTGG - Intergenic
994086575 5:95765947-95765969 CATCACCGGGCTGGGCACGGTGG - Intronic
995438224 5:112160955-112160977 GGGCGCCGGGCGGGGGAACGCGG + Intronic
996329334 5:122312008-122312030 GGGCGCCCGGCCGGGGACGGGGG - Intronic
996937477 5:128965443-128965465 CGGGGCTGGGCGGGGCAGGACGG + Exonic
997301997 5:132813384-132813406 CGGGGCCCGGCGGGGCGCTGGGG + Intergenic
997583983 5:135034046-135034068 CGGCGCCGGGCGGGCAGAGGCGG + Exonic
998435888 5:142108697-142108719 CCGGGCCGGGCCGGGCAGGGCGG + Exonic
999156345 5:149460223-149460245 AGCCGCTGGGCTGGGCACGGTGG + Intergenic
999419050 5:151425256-151425278 CGGCGCGGGGCGGGGCGCCGGGG - Intergenic
1000090751 5:157927882-157927904 AGATGCCGGGCCGGGCACGGCGG + Intergenic
1000348125 5:160331509-160331531 GGGCTTCGGGCTGGGCACGGTGG - Intronic
1001577055 5:172771322-172771344 CGGCGCCTGGCCTGGCAGGGCGG - Intergenic
1001716284 5:173818847-173818869 GGGCTCTGGGCTGGGCACGGTGG + Intergenic
1002057984 5:176609776-176609798 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1002057987 5:176609781-176609803 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1002541292 5:179907923-179907945 CGGGGCGGGGCGGGGCCGGGCGG + Intergenic
1002645275 5:180649634-180649656 CGGGGCGGGGCGGGGGCCGGAGG + Intergenic
1003099050 6:3163166-3163188 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1003173492 6:3738022-3738044 AGGCCCCGGGCTGGGCAGGGAGG - Intronic
1003412098 6:5874605-5874627 CAGCCACGGGCCGGGCACGGTGG - Intergenic
1004167994 6:13273903-13273925 CGGGGCGGGGCGGGGCGGGGGGG - Intronic
1004339318 6:14794477-14794499 CTGAGCCGGGTGGGGCATGGGGG + Intergenic
1004690337 6:17987668-17987690 GCGCGCGGGGCGGGGCGCGGCGG + Intergenic
1004722273 6:18277688-18277710 CCGCGGCGGGCGGCCCACGGGGG + Intergenic
1005041610 6:21605641-21605663 CAGCTCTGGGCCGGGCACGGTGG + Intergenic
1005457574 6:26035588-26035610 CTGCTCCTGGCTGGGCACGGTGG + Intergenic
1005584132 6:27259733-27259755 TGCCCCCGGGCCGGGCACGGTGG - Intergenic
1005612947 6:27544430-27544452 GGGGGGCGGGCGGGGCGCGGGGG - Intergenic
1005859253 6:29888416-29888438 CGGGGCAGGGCGGGGCTCGGGGG + Intergenic
1005866820 6:29943217-29943239 CGGGGCTGGGCGGGGCTCGGGGG + Intronic
1006043122 6:31271377-31271399 CGGGGCGGGGCGGGGCTCGGGGG - Intronic
1006052712 6:31356471-31356493 CGGGGCGGGGCGGGGCTCGGGGG - Intronic
1006114952 6:31770600-31770622 CAGTGCAGGGCGGGGCAGGGCGG + Intronic
1006303881 6:33207825-33207847 CGGCCCGGGGCGGGGAAGGGAGG - Intergenic
1006475367 6:34249261-34249283 CGGGGCCGGACGGGGTAGGGCGG + Exonic
1006512128 6:34527176-34527198 CGCCGCGGGGCGGGGGGCGGGGG + Intronic
1006665296 6:35688942-35688964 CGGCGCCGGGCGCTGCCCCGGGG - Intronic
1006767910 6:36525062-36525084 CGGGGCCTGTCGGGGCATGGGGG + Intronic
1006774020 6:36577949-36577971 CGTTGCCAGGCCGGGCACGGTGG - Intergenic
1006774792 6:36583948-36583970 CGAAGCCGGGCGGATCACGGAGG - Intergenic
1006932827 6:37697795-37697817 CGGGGCCGGGCCGGGCTCCGGGG + Exonic
1007111137 6:39314049-39314071 CGGCGTCGGCCTGGGCGCGGCGG - Intronic
1007431507 6:41779894-41779916 CGGGGCGGGGCGGGGCGGGGAGG - Exonic
1007465842 6:42050467-42050489 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1007479031 6:42137822-42137844 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1007600118 6:43076229-43076251 GGGCGCCGTGCGGGGGCCGGAGG + Intergenic
1007800508 6:44388150-44388172 CGGGGCCGGGGGGGGCGGGGGGG - Intronic
1010703363 6:79077961-79077983 CGGCGGGGGGCGGGGGACCGCGG + Intronic
1011416269 6:87122826-87122848 CGGCGCGGGGCGGGCCCTGGCGG - Intergenic
1011610431 6:89145964-89145986 CGGCGCCGCGCGGGAAACGCTGG - Intergenic
1011734447 6:90297044-90297066 GGGCGGGGGGCGGGGGACGGGGG + Intergenic
1011837612 6:91452903-91452925 AGCCACCGGGCTGGGCACGGTGG - Intergenic
1012875462 6:104720924-104720946 CGTCGCTGGGCCGGGCGCGGTGG - Intergenic
1013099389 6:106974546-106974568 TGGCGCCCGGCGGGGCTCGAGGG - Intronic
1013273361 6:108561451-108561473 CGGCGGCGGGAGCGGCACGCTGG + Exonic
1013372597 6:109483366-109483388 CGGGGCGGGGCGGGGCAAGGCGG + Intergenic
1013372646 6:109483496-109483518 CGCGGCGGGGCGGGGCAGGGCGG + Intergenic
1013576039 6:111483806-111483828 CGGCTCCGCGCGTGGCCCGGGGG + Intergenic
1013758114 6:113484473-113484495 AGGGGCCAGGCCGGGCACGGTGG - Intergenic
1014098179 6:117482581-117482603 CGGGGCGGGGCGGGGCCGGGCGG + Intronic
1015496154 6:133885609-133885631 AGGCACCTGGCTGGGCACGGTGG + Intergenic
1015625768 6:135180505-135180527 CTGGGCCGGGCGGGGCGGGGTGG + Intergenic
1015737865 6:136420333-136420355 CGCGGCCGGGCTGGGCACGCAGG - Intronic
1015970421 6:138738041-138738063 CTATGCCGGGCTGGGCACGGTGG + Intergenic
1015999642 6:139029472-139029494 CGGCGCCGGGCCGGGAGCTGCGG + Intronic
1016340819 6:143060478-143060500 GGGCGCCGGGCCGGGCGAGGGGG - Intronic
1016340911 6:143060802-143060824 GGGCGCGGGGCGGGGCGGGGCGG - Intronic
1017010052 6:150057559-150057581 TGGCCCCGGGCGGGTCACCGCGG + Intergenic
1017560916 6:155627377-155627399 CAGACCTGGGCGGGGCACGGTGG + Intergenic
1017671942 6:156777642-156777664 CGAGGCCGGGCGGGGGGCGGGGG - Intergenic
1017671984 6:156777763-156777785 GGGCGCCGGCCGCGGCCCGGGGG - Intergenic
1017738221 6:157381941-157381963 CGGCGGCGGTCGTGGCTCGGCGG + Exonic
1017810708 6:157981737-157981759 CGGGGCCGGGCGGGAGGCGGCGG + Intergenic
1018013603 6:159693338-159693360 GGGCGCGGGGCGGGGCCCGCGGG - Intronic
1018876778 6:167827576-167827598 CGGCGGCGCGGGGGGCGCGGCGG + Intronic
1019111914 6:169723971-169723993 CGGCGGCGGCCGGGACAAGGCGG - Exonic
1019337400 7:491853-491875 CAGCGCTGGGCAGGGCAAGGTGG + Intergenic
1019485918 7:1289155-1289177 TGGCTCCGGGTGGGACACGGAGG - Intergenic
1019488112 7:1298789-1298811 AGGCGACGGGCGTGGCACGCTGG + Intergenic
1019656635 7:2199615-2199637 CCGTGCCAGGCGGGGCACTGCGG - Intronic
1019765161 7:2844357-2844379 CGGCGCCGCGTGAGGCCCGGCGG + Intergenic
1020034992 7:4959229-4959251 CGGGGCGGGCGGGGGCACGGGGG + Intergenic
1020274301 7:6615513-6615535 CGGCGGGGGCCGGGGCGCGGGGG + Intergenic
1023381151 7:39609801-39609823 CGGAGCCGGGCGGGGAAGCGGGG - Intronic
1023791862 7:43758891-43758913 CGGGCCCGGGCGGGGCGGGGCGG - Intronic
1023850280 7:44146294-44146316 GGGCCCGGGGCGGGGCACAGGGG - Intronic
1024504319 7:50148857-50148879 TGGGGCTGGGCCGGGCACGGTGG + Intronic
1024580051 7:50793631-50793653 GGGCGCAGGGCGTGGCGCGGGGG + Intergenic
1024793522 7:52994618-52994640 GGGGGCAGGGCTGGGCACGGTGG + Intergenic
1025004433 7:55343563-55343585 CGCCGGTGGGCGGGGCACCGCGG - Intergenic
1025069783 7:55887848-55887870 CGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025139098 7:56448058-56448080 CGGCGCAGGGTGGGGCTGGGCGG - Intergenic
1025917038 7:65873701-65873723 CGGGGCCAGGCGGGGGGCGGCGG + Intronic
1026470932 7:70693962-70693984 CGGCGAGGGGCGGGGCGCGCGGG + Intronic
1026837387 7:73647859-73647881 AGGCGCCGGGCGCGGTCCGGCGG - Intergenic
1026909497 7:74083963-74083985 CGACGGGGGGCGGGGCCCGGCGG - Exonic
1029123133 7:98281574-98281596 CGGCGGGAGGCGGGGCTCGGGGG - Intronic
1029238760 7:99143870-99143892 CGGCTCCGGGCTGGGCGCCGGGG + Exonic
1029324512 7:99794553-99794575 AGGAGCCTGGCTGGGCACGGTGG - Intergenic
1029483830 7:100827532-100827554 CGGCGCCGGGCCCGGGAGGGAGG + Intronic
1029494476 7:100889719-100889741 CGGGGCGGGGCGGGGCGCGGCGG - Intergenic
1030519499 7:110580096-110580118 TGGCCCTGGGCTGGGCACGGTGG - Intergenic
1031051874 7:116953415-116953437 CGGCGGCGGGCGGGCTCCGGGGG + Exonic
1032041749 7:128568754-128568776 TGGCTCAGGGCTGGGCACGGTGG - Intergenic
1033361476 7:140641163-140641185 CGGCACCGGGCCGGGGCCGGGGG + Intronic
1033711520 7:143951038-143951060 TGGGGGCGGGCCGGGCACGGTGG - Intergenic
1034085424 7:148317966-148317988 CAGGGCAGGGCCGGGCACGGAGG - Intronic
1034183581 7:149157245-149157267 CAGGACAGGGCGGGGCACGGTGG + Intronic
1034228038 7:149497868-149497890 CGGGGCTGGGCGGGGCGGGGCGG - Intergenic
1034469715 7:151248741-151248763 CGGCGGCGGGCGGGCGGCGGCGG - Exonic
1034618064 7:152436013-152436035 AGGGGCCGGGCGGGGGGCGGCGG + Intergenic
1034829929 7:154300193-154300215 TGGAGCCTGGCGGGGCATGGGGG - Intronic
1034976903 7:155454210-155454232 AGGCGCCGGGCGGGGAATTGGGG - Intergenic
1035404383 7:158588126-158588148 CCGGGCCGGGCGGGGAGCGGCGG - Intergenic
1035476279 7:159145676-159145698 CGGCGGCGGGTGGGGAACGCTGG + Intergenic
1035512981 8:206466-206488 CGCCGCCGGGCGGGGAGCGCGGG + Intergenic
1035717077 8:1763409-1763431 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717086 8:1763426-1763448 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717095 8:1763443-1763465 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717104 8:1763460-1763482 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717113 8:1763477-1763499 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717122 8:1763494-1763516 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717131 8:1763511-1763533 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717140 8:1763528-1763550 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717149 8:1763545-1763567 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717158 8:1763562-1763584 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717167 8:1763579-1763601 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1036380914 8:8235959-8235981 GGGCGCAGGGCAGGGCACCGAGG + Intergenic
1036701600 8:11016750-11016772 CGGCTCAGAGCGGGGCAAGGAGG - Intronic
1036739430 8:11347595-11347617 GTGCGCCGGGCGGGGCGGGGCGG + Intergenic
1036950332 8:13133544-13133566 AGGCGCGGGGCGGGGCGGGGGGG - Intronic
1037273603 8:17156158-17156180 TGGCGCAGGGCGGGGGTCGGAGG - Exonic
1037339665 8:17831107-17831129 TGGTGCTGGGCGGGGCACGGTGG + Intergenic
1037589961 8:20303978-20304000 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1037589964 8:20303983-20304005 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1037589967 8:20303988-20304010 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1037811457 8:22089363-22089385 CGGAGCCGGGCGCGGCCCGCAGG + Intronic
1038304113 8:26383520-26383542 CGGAGCCGGGCGGGGCGGGGCGG + Intronic
1038808060 8:30812645-30812667 CGCGGCCGGGCGGGGAAGGGCGG - Exonic
1039174266 8:34784994-34785016 CGCCTCCGGCCGGGGCACGGTGG - Intergenic
1039476443 8:37841611-37841633 GGGCCCGGGGCGGGGCATGGGGG - Exonic
1039484402 8:37899618-37899640 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1039976628 8:42372064-42372086 TGGGGGGGGGCGGGGCACGGTGG + Intergenic
1040065346 8:43140443-43140465 CAGCGCAGGGCGGGGCGCAGCGG + Exonic
1040505000 8:48039185-48039207 AGGGGTCGGGCGAGGCACGGTGG - Intronic
1041673607 8:60516825-60516847 AGGCGCGGGGCGGGGCGGGGCGG + Intergenic
1042020860 8:64370472-64370494 CGGCGGCGGGCGGCGAACTGAGG + Intergenic
1043873827 8:85463790-85463812 TGGCGCCCGGCGGGGCTCCGGGG - Intergenic
1044591518 8:93917512-93917534 CGGGGCCGGGCCGGGCAGGGCGG + Intronic
1044698964 8:94949409-94949431 CGGCCCGGGGCGGGGCAGCGGGG - Exonic
1044734805 8:95268755-95268777 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1044734808 8:95268760-95268782 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1044734811 8:95268765-95268787 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1044734814 8:95268770-95268792 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1045063458 8:98426958-98426980 CTGCGCGGGGCGCGGCGCGGTGG - Intronic
1045277480 8:100721311-100721333 CGGCGGCGGGCGGGGTAGGCCGG - Intronic
1045510019 8:102806716-102806738 CGGGGCCGGGCCGGGCTGGGTGG + Intergenic
1047213289 8:122857017-122857039 CTGTGGCGGGAGGGGCACGGTGG - Intronic
1047381874 8:124372068-124372090 GGACGGCGGGCGGGGCGCGGCGG + Exonic
1048553911 8:135457380-135457402 GGGCGCGGGGCGGGGCGGGGCGG + Intergenic
1049199899 8:141334871-141334893 CAGCTCCGTGCGGAGCACGGGGG + Intergenic
1049609717 8:143549017-143549039 AGGCGTTGGGCCGGGCACGGTGG - Intergenic
1049657402 8:143804876-143804898 GGGCGCGGGGCGGGGCAGGGGGG + Intronic
1049673172 8:143878545-143878567 CGACGCGGGGCGGGGCGGGGCGG + Intergenic
1049716367 8:144094995-144095017 CGGGGCGGGGCCGGGCTCGGGGG - Intergenic
1049718416 8:144104467-144104489 AGGCGCGGGGCCGGGCCCGGCGG + Intronic
1049752362 8:144291364-144291386 CGGCGCGCGGTGGGGCATGGCGG - Exonic
1049762280 8:144336911-144336933 CGGCGGCGGGCGGGGGGCGGGGG + Intergenic
1049801131 8:144517974-144517996 CGGCGCCGGGCGGGGAGCGGCGG + Intronic
1049883077 9:11154-11176 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
1049998375 9:1051714-1051736 CGGCGGCGGGCTGGGCCCGGGGG - Exonic
1050230892 9:3525491-3525513 CGGCGCAGGGCCGGGGCCGGCGG + Intronic
1050472295 9:6007031-6007053 CGGCGCTGGGCGGGGACCGGAGG - Intronic
1050472711 9:6008514-6008536 CGTAGCGGGGCGGGGCACGATGG - Intergenic
1053003308 9:34589655-34589677 CGGCGCGGCGCGAGGCTCGGCGG - Exonic
1053016540 9:34665388-34665410 CAGAGCCGGGCGGGGCGGGGCGG + Intronic
1053016547 9:34665398-34665420 CGGGGCGGGGCGGGGCGGGGAGG + Intronic
1053545778 9:39021398-39021420 GGGAGACGGGCTGGGCACGGTGG - Intergenic
1053835346 9:42129343-42129365 CGGCGCCGCCCCAGGCACGGAGG + Exonic
1054091015 9:60847306-60847328 CGGCGCCGCCCCAGGCACGGAGG + Intergenic
1054112426 9:61122862-61122884 CGGCGCCGCCCCAGGCACGGAGG + Intergenic
1054595279 9:67059267-67059289 CGGCGCCGCCCCAGGCACGGAGG - Intergenic
1056143639 9:83707983-83708005 CGGCGCCGCGCGGAGCACGCCGG + Exonic
1056643347 9:88388832-88388854 CGGCGGCGGCCGGGGAACTGGGG - Intronic
1057146859 9:92764463-92764485 CGGCGCCGGGCGGGGGTCGCAGG + Intronic
1057313503 9:93955404-93955426 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1057313506 9:93955409-93955431 CGGCGCGGGGCGGGGCGGGGCGG - Intergenic
1057781914 9:98056972-98056994 GGGCGCCGGGAGGGGCGGGGCGG + Intronic
1057995629 9:99820034-99820056 CGGGGCGGGGCGGGGCGGGGCGG - Intergenic
1058149556 9:101449270-101449292 CAGAGCCGGGTGGGGCATGGAGG + Intergenic
1060468663 9:123929928-123929950 CAGCGCCGAGCGGGGCCCGCGGG - Exonic
1060477919 9:123999598-123999620 CGGCGGCGGGCGGGGTGGGGAGG + Intergenic
1060485000 9:124041157-124041179 CGCCCCCTGGCGGGGCACCGCGG + Intergenic
1060629446 9:125143120-125143142 CGGGGCCGGGAGGGGCAAGGCGG - Intronic
1060849275 9:126860915-126860937 CGAGGCCGGGCGGGGTCCGGAGG + Intronic
1060855931 9:126915030-126915052 CGGGGCGGGGCGGGGCGGGGCGG + Intronic
1060945906 9:127569189-127569211 CGGGGCGGGGCGGGGCGGGGTGG - Intronic
1060945961 9:127569288-127569310 CTCCGGCGGGCGGGGCACAGGGG + Intronic
1061165976 9:128922373-128922395 CGGGGCCGGGAGGGTCATGGCGG + Intronic
1061181708 9:129028324-129028346 GCGCGCAGGGCGGGGCGCGGAGG + Intergenic
1061317155 9:129803438-129803460 CGGCGCTGCGGGGGGCGCGGGGG + Intronic
1061346910 9:130033703-130033725 CCAGGCCGGGCTGGGCACGGTGG + Intronic
1061542111 9:131283056-131283078 CGGCGGGGGGCGGGGGACCGCGG - Intergenic
1062022306 9:134325467-134325489 GGGCGGCGGGCGGCGCGCGGCGG + Intronic
1062162475 9:135087843-135087865 CGGCGGCGGGCGGGCGGCGGCGG + Exonic
1062179991 9:135186196-135186218 CGGCGGGGGGCAGGGCACAGGGG - Intergenic
1062341289 9:136094956-136094978 GGGGGCCGGGCGGGGCCGGGGGG - Intronic
1062349849 9:136133300-136133322 CGGGGCGGGGCGGGGCAGGCCGG - Intergenic
1062476246 9:136728777-136728799 CCGCGCAGGGCGGGACACCGAGG + Intergenic
1062504627 9:136866596-136866618 CGGGGCCCGGGGAGGCACGGGGG - Intronic
1062548986 9:137077402-137077424 CGGGGCGGGGCGGGGCGGGGCGG + Intergenic
1062614849 9:137391630-137391652 CGGGGCGGGGCGGGGCAGGGAGG - Intronic
1062646756 9:137551765-137551787 CGGGGCGGGGCGGGGCTCGCGGG - Exonic
1062696401 9:137878231-137878253 CGGGGCCGGGCGGGGCCGGGCGG + Intronic
1185447613 X:267800-267822 CGTCGCCGGGCCGGGCGTGGTGG - Intergenic
1185774140 X:2788565-2788587 TGGGGCAGGGCTGGGCACGGTGG + Intronic
1187181344 X:16946551-16946573 TGGCGCTGGGCGGGGCAAGCGGG + Intergenic
1188242679 X:27809531-27809553 CGGGGCGGGGCGGGGGCCGGCGG - Intronic
1190007993 X:46758640-46758662 CGGCGCCAGGAGGAGCGCGGCGG + Intronic
1190202609 X:48376538-48376560 CAACGCTGGGCTGGGCACGGTGG + Intergenic
1190207929 X:48418872-48418894 CAACGCTGGGCTGGGCACGGTGG - Intergenic
1190246956 X:48696963-48696985 CGGGGCTGGGCGGGGCTCAGGGG + Intronic
1190812436 X:53897453-53897475 CGACTGCGGGCCGGGCACGGTGG + Intergenic
1190881461 X:54495402-54495424 CGGCGCCCCCCGGGGCTCGGTGG + Exonic
1191829972 X:65406567-65406589 CGGGGCTGGGCGGGGCTGGGCGG + Intronic
1191829977 X:65406577-65406599 CGGGGCTGGGCGGGGCTGGGCGG + Intronic
1191829982 X:65406587-65406609 CGGGGCTGGGCGGGGCTGGGCGG + Intronic
1191829987 X:65406597-65406619 CGGGGCTGGGCGGGGCTGGGCGG + Intronic
1192166699 X:68831182-68831204 CGGGGCAGGGCGGGGCTGGGGGG - Intronic
1192776620 X:74252268-74252290 TGGTGCCAGGCCGGGCACGGTGG + Intergenic
1194065174 X:89252638-89252660 CTAGGCCGGGCTGGGCACGGTGG + Intergenic
1194133719 X:90112591-90112613 CGGAGCCGGGCGGGGGAGGACGG - Intergenic
1195728043 X:107937192-107937214 GGGCGCGGGGCGGGGGACGGAGG - Intergenic
1196196581 X:112843251-112843273 CGGTACTGGGCTGGGCACGGTGG + Intergenic
1196684086 X:118495944-118495966 CGGCGGCGGGCGGGTCTCGGCGG - Exonic
1196972630 X:121126112-121126134 ATGCCCCGGGCCGGGCACGGTGG - Intergenic
1197248182 X:124188051-124188073 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1197248185 X:124188056-124188078 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1197695010 X:129540628-129540650 CGGGGCGGGGCGGGGGAGGGCGG + Intronic
1197754304 X:129983707-129983729 GGCCGCCGGGCCGGGCGCGGCGG + Intronic
1198398990 X:136251453-136251475 CGGGGCGGGGCGGGGCGGGGCGG + Exonic
1198398993 X:136251458-136251480 CGGGGCGGGGCGGGGCGGGGCGG + Exonic
1198398996 X:136251468-136251490 CGGGGCGGGGCGGGGCCCGAAGG + Exonic
1199772718 X:150984326-150984348 CGGGGCGGGGCGGGGCGGGGTGG + Intronic
1199967282 X:152830884-152830906 CAGCGCGGGGAGGGGCACGCTGG + Intergenic
1200084882 X:153599182-153599204 CGGCGAGGGGCGGGGCGGGGCGG - Exonic
1200084892 X:153599202-153599224 CGGCGAGGGGCGGGGCGGGGCGG - Intronic
1200084902 X:153599222-153599244 CGGCGAGGGGCGGGGCGGGGCGG - Intronic
1200138535 X:153886264-153886286 CGGGGCGGGGCGGGGCGGGGCGG - Intronic
1200229444 X:154436857-154436879 CGGGGCGGGGCGGGGCGCGGCGG + Intergenic
1200402724 X:156028987-156029009 CGGCGCCGGGCTGGGGGCGGGGG - Intergenic