ID: 1126163515

View in Genome Browser
Species Human (GRCh38)
Location 15:45634926-45634948
Sequence GGCGCCGGGCGGGGCACGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1228
Summary {0: 1, 1: 0, 2: 12, 3: 137, 4: 1078}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126163506_1126163515 -5 Left 1126163506 15:45634908-45634930 CCATGGTGCCTGGGCTGCGGCGC 0: 1
1: 0
2: 2
3: 19
4: 253
Right 1126163515 15:45634926-45634948 GGCGCCGGGCGGGGCACGGCGGG 0: 1
1: 0
2: 12
3: 137
4: 1078
1126163501_1126163515 12 Left 1126163501 15:45634891-45634913 CCTGGTGTGTTCACTGACCATGG 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1126163515 15:45634926-45634948 GGCGCCGGGCGGGGCACGGCGGG 0: 1
1: 0
2: 12
3: 137
4: 1078
1126163500_1126163515 13 Left 1126163500 15:45634890-45634912 CCCTGGTGTGTTCACTGACCATG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1126163515 15:45634926-45634948 GGCGCCGGGCGGGGCACGGCGGG 0: 1
1: 0
2: 12
3: 137
4: 1078
1126163499_1126163515 29 Left 1126163499 15:45634874-45634896 CCGTGAGCGCTCAACGCCCTGGT 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1126163515 15:45634926-45634948 GGCGCCGGGCGGGGCACGGCGGG 0: 1
1: 0
2: 12
3: 137
4: 1078
1126163497_1126163515 30 Left 1126163497 15:45634873-45634895 CCCGTGAGCGCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1126163515 15:45634926-45634948 GGCGCCGGGCGGGGCACGGCGGG 0: 1
1: 0
2: 12
3: 137
4: 1078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126163515 Original CRISPR GGCGCCGGGCGGGGCACGGC GGG Exonic
900019990 1:181567-181589 GGCGCCGGGCTGGGGGCGGGGGG + Intergenic
900159667 1:1217485-1217507 GGGGCGGCGCGGGGCGCGGCCGG + Exonic
900349264 1:2227257-2227279 GCCGGCGGGCGGGGCGGGGCCGG + Intergenic
900349561 1:2228190-2228212 GGCGGCGGGCGCGACGCGGCCGG + Intergenic
900607656 1:3531054-3531076 GGCGCCGGGCGAGCCTGGGCAGG - Intronic
900607774 1:3531415-3531437 GGCGAGGGGCGGGGCGCGCCCGG - Intronic
900969042 1:5979332-5979354 GGGGCGGGGCAGGGCAGGGCAGG + Intronic
900969044 1:5979337-5979359 GGGGCAGGGCAGGGCAGGGCAGG + Intronic
901007701 1:6179847-6179869 GGCGGCGGGGGCGGCGCGGCCGG - Intronic
901242811 1:7704784-7704806 GGCGCGGGGCCGGGCTGGGCCGG + Intronic
901242813 1:7704789-7704811 GGGGCCGGGCTGGGCCGGGCCGG + Intronic
901242823 1:7704804-7704826 CGGGCCGGGCGGGGCCGGGCGGG + Intronic
901443369 1:9292797-9292819 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
901443371 1:9292802-9292824 GGGGCGGGGCGGGGCGGGGCAGG + Intergenic
901443373 1:9292807-9292829 GGGGCGGGGCGGGGCAGGGACGG + Intergenic
901641354 1:10694634-10694656 GGCACCGGGCGGCGGGCGGCGGG - Intronic
901703116 1:11055960-11055982 GGGGCGGGGTGGGGCAGGGCAGG - Intronic
901833673 1:11909551-11909573 GGGGCACGGCGGGGCACGGCGGG - Intergenic
901833677 1:11909561-11909583 GGGGCACGGCGGGGCACGGCGGG - Intergenic
901833681 1:11909571-11909593 GGGGCACGGCGGGGCACGGCGGG - Intergenic
901833685 1:11909581-11909603 GTCGCATGGCGGGGCACGGCGGG - Intergenic
902214291 1:14924580-14924602 CGCGCGGGGCGGGGCGGGGCGGG + Intronic
902232402 1:15036316-15036338 GGAGCCGGGCGGGGCAGGCTAGG - Intronic
902330729 1:15730051-15730073 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
902330732 1:15730056-15730078 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
902336732 1:15758606-15758628 GGGGCGGCGCGGGGCGCGGCCGG + Intronic
902336734 1:15758611-15758633 GGCGCGGGGCGCGGCCGGGCAGG + Intronic
902585802 1:17438180-17438202 GGCGCAGGGCCGGGGCCGGCGGG - Intronic
902626572 1:17680061-17680083 GGGGCAGGGTGGGGCAAGGCGGG - Intronic
902940953 1:19799910-19799932 GGGGCCGGGCCGGGCCGGGCGGG - Exonic
903184746 1:21622610-21622632 GGCGCGGGGCGGGGCGGGGCGGG + Intronic
903263321 1:22142801-22142823 GGGGCGGGGCGGGGCGGGGCAGG - Intronic
903263327 1:22142811-22142833 GGGGCCGAGCGGGGCGGGGCGGG - Intronic
903263614 1:22143656-22143678 GGGGCCGGGCGGGGGGCGGTCGG - Intronic
903413830 1:23168291-23168313 GGGGCTGCGCGGGGCCCGGCGGG - Intronic
903466392 1:23554972-23554994 GGCGCCGGGAGGGGCGGGGCGGG + Intergenic
903536244 1:24068174-24068196 GGGGCAGGGCGGGGCAGGGCTGG + Intronic
903597136 1:24503161-24503183 AGCGCGGGGCGGGGCGGGGCGGG + Intronic
903597139 1:24503166-24503188 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
903643513 1:24876362-24876384 GGGGCGGGGCGGGGCGGGGCAGG + Intergenic
904266225 1:29319852-29319874 GGCACAGGGTGGGGCAGGGCAGG + Intronic
904384065 1:30130239-30130261 GGAGCTGGGCGGGGCACTGCTGG - Intergenic
904541955 1:31239446-31239468 GGGGCAGGGTGGGGCGCGGCGGG - Intronic
904591413 1:31617621-31617643 GCCGGCGGGAGGGGCAGGGCGGG - Intergenic
905212812 1:36385968-36385990 GGCGGAGGGCGGGGCCCGGGGGG - Intergenic
905414377 1:37794375-37794397 GGCGGCGGGGGCGGCGCGGCAGG - Exonic
905789836 1:40784067-40784089 GGCGCCGGGCTGGGGGCGCCGGG - Exonic
906044415 1:42817075-42817097 GGGGCCGGGCGGGCCGGGGCGGG - Intronic
906087376 1:43147767-43147789 GGCGCGGGGCGGGGCGATGCAGG + Intronic
906116140 1:43358725-43358747 GGGACAGGGCGGGGCAGGGCGGG - Intergenic
906130753 1:43453835-43453857 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
906130756 1:43453842-43453864 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
906627039 1:47333881-47333903 GGCGCGGCGCGGGGCGGGGCGGG - Exonic
906637129 1:47417028-47417050 GGCGTCGGGCGCGGCGCAGCAGG - Exonic
907045520 1:51297945-51297967 GGAGCTGGGCAGGGCACAGCAGG - Intronic
907069312 1:51519375-51519397 GGGGCCAGGCGGGGCGGGGCGGG - Intergenic
907351793 1:53838112-53838134 CGCGCTGGGCGGGGGAGGGCCGG - Intronic
907920016 1:58903666-58903688 GCGGCGGGGCGGGGCAGGGCCGG + Intergenic
908014166 1:59814727-59814749 GGGGGCGGGCGGGGCGGGGCGGG - Intergenic
908477757 1:64505841-64505863 GGGGCGGGGCGGGGCGAGGCCGG - Intronic
908477760 1:64505851-64505873 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
908523513 1:64966562-64966584 GCCGCGGGGCGGGGCGGGGCGGG - Intergenic
910221492 1:84893247-84893269 GGGGCGGGGCGGGGCAGGGAGGG - Intergenic
910550275 1:88467162-88467184 GGGGCCGGGCCGGGCCGGGCCGG - Intergenic
910787992 1:91021650-91021672 GCCGCGGGGCGGGACTCGGCGGG - Intronic
911052235 1:93681197-93681219 GGGGACGGGCGGGACAGGGCGGG + Intronic
911079017 1:93909589-93909611 GGCGACGGGTGGTGCGCGGCGGG + Intergenic
912430330 1:109625349-109625371 GGCAGGGGGCGGGGCCCGGCAGG - Exonic
912716974 1:111989892-111989914 CGCGCCGAGCGGAGCCCGGCCGG + Intergenic
912878954 1:113390404-113390426 CGCGCCGGGCGCCGCGCGGCGGG + Intergenic
913047952 1:115089546-115089568 GGGGCGGGGCGGGGCCCGGCGGG + Intergenic
913109044 1:115641824-115641846 AGCGGAGGGCGGGGCTCGGCCGG - Intergenic
914777307 1:150749574-150749596 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
914777323 1:150749604-150749626 GGGGCAGGGCAGGGCAGGGCAGG - Intronic
914937472 1:151993623-151993645 GGGGCTGGGCGGGGAGCGGCTGG - Intronic
915106126 1:153536076-153536098 GGCGCAGGGTGGGGCGCGGGCGG - Intronic
915141452 1:153771029-153771051 GGCGGTGGGGGGGGCGCGGCGGG - Intronic
915333506 1:155127798-155127820 CGCGCCGGGCGGGGCGAGGGCGG + Exonic
915953448 1:160205299-160205321 GGCGGGGGGCGGGGAATGGCGGG - Intergenic
916259053 1:162822516-162822538 GGCGCTGGGCTGGGCCCGGGAGG + Intergenic
917291574 1:173477175-173477197 GGCGCGGGGCGGGGCTGGGCCGG - Intergenic
917291584 1:173477197-173477219 GGCGCGGGGCGGGGCGGGGCTGG - Intergenic
917456810 1:175192818-175192840 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
917456813 1:175192823-175192845 GGAGCGGGGCGGGGCGGGGCGGG - Intronic
917755485 1:178094071-178094093 GGAGCGGGGCCGGGCAGGGCTGG - Intergenic
917920030 1:179743464-179743486 GGGGCGGGGCGGGGCGCGGGCGG + Intronic
917929366 1:179813086-179813108 GGCGCCGGGCGGATGACAGCGGG + Exonic
919101834 1:193105460-193105482 GGGACGGGGCGGGGCAAGGCGGG - Intronic
919705146 1:200669352-200669374 GGTGGCGGGCGGGGCAGGGACGG + Intronic
919809396 1:201399327-201399349 GGCGGCCGGCGGGGCGCGGGCGG - Exonic
919822179 1:201480541-201480563 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
919822182 1:201480546-201480568 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
919822185 1:201480551-201480573 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
920648162 1:207818273-207818295 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
920648165 1:207818278-207818300 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
920648168 1:207818283-207818305 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
920648171 1:207818288-207818310 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
920648174 1:207818293-207818315 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
920648177 1:207818298-207818320 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
920648180 1:207818303-207818325 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
920648199 1:207818343-207818365 GGGACGGGGCGGGGCAGGGCGGG + Intergenic
921060149 1:211578629-211578651 GTCTCCGGGCCGGGCTCGGCGGG - Exonic
921167136 1:212515243-212515265 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
921167139 1:212515248-212515270 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
921198724 1:212783145-212783167 GACGCAGGGCAGGGCAGGGCAGG + Intronic
922287572 1:224183384-224183406 GGCGCCGGTCGGCGTGCGGCTGG - Exonic
922860167 1:228809818-228809840 GGGGCAGGGCAGGGCAGGGCAGG - Intergenic
922950844 1:229558050-229558072 GGCGCCGAGAGGGACACGGCCGG - Intronic
923107907 1:230868561-230868583 GGCGCGGGGCGGGGCGAGGGCGG - Exonic
923505304 1:234600242-234600264 GACCCCGGGCGGGGCGGGGCGGG - Intergenic
923631055 1:235649821-235649843 GGCGCGGCGCGGGGCGGGGCCGG - Exonic
923744339 1:236686574-236686596 GGCGGCGGGCGGCGGGCGGCGGG - Exonic
924527089 1:244863107-244863129 GGAGCCGGGCGGGGCGGGGCGGG - Intronic
924527264 1:244863692-244863714 GGCGCCGCCCGGGGCGAGGCAGG - Exonic
1063417965 10:5889385-5889407 GGCGGCGGGCGGGACACCGGCGG + Exonic
1063452991 10:6163827-6163849 GGGGCCGCGCGGCGCACGCCGGG - Intronic
1063459106 10:6204105-6204127 GGCGACCGGCGGGGCGGGGCAGG - Intronic
1063511355 10:6647843-6647865 GCCGCAGCGCGGGGCCCGGCGGG + Intergenic
1063576519 10:7266530-7266552 GGAGCTGGAGGGGGCACGGCAGG + Intronic
1064645321 10:17454116-17454138 CGCGCGGCGCGGGGCGCGGCCGG + Intronic
1065025241 10:21534555-21534577 GGCGCCGGGGCGGGCTCGGGGGG + Intronic
1065483596 10:26216685-26216707 GGCACCGCGCGGGGACCGGCGGG - Exonic
1065771189 10:29080313-29080335 GGCTCCGGTCTGGGCAGGGCAGG - Intergenic
1066004402 10:31133785-31133807 GGCGCCGGGCCTGCCACGCCCGG - Intergenic
1067071741 10:43137828-43137850 GGTGCCGGGCGCGTCACCGCGGG - Intergenic
1067471422 10:46541298-46541320 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1067478030 10:46579006-46579028 GGAGCCGCGCAGTGCACGGCAGG - Intronic
1067616710 10:47762781-47762803 GGAGCCGCGCAGTGCACGGCAGG + Intergenic
1067841009 10:49679588-49679610 CGCGCCGGGCGGGGCCGGGGTGG - Intergenic
1069651751 10:70053946-70053968 GGAGCCGGGGGAGGCAGGGCTGG - Intronic
1069705740 10:70458338-70458360 GGCGCCCGGCCAGGCGCGGCGGG - Intergenic
1069849624 10:71396728-71396750 GGGTCCGGGCGGGGCCGGGCGGG + Intergenic
1070257689 10:74825745-74825767 GGAGCCGGGGGGTGCACGCCCGG + Intronic
1070570892 10:77638548-77638570 GGCTCCGGGCTGGGCAGGGGTGG + Intronic
1070586816 10:77772682-77772704 GACCCCGGGCCGGGCAAGGCTGG - Intergenic
1070950804 10:80429527-80429549 GGGGCGGGGCAGGGCAGGGCCGG - Intronic
1070950806 10:80429532-80429554 GGGGCGGGGCGGGGCAGGGCAGG - Intronic
1070950830 10:80429594-80429616 GGGGCAGGGCAGGGCAGGGCAGG - Intronic
1071997681 10:91163327-91163349 GGCGCCGGGCGGGCAAGGGGAGG + Intronic
1072253613 10:93600831-93600853 GGCGTCCGGGGGCGCACGGCGGG + Intronic
1072670481 10:97425909-97425931 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
1072970058 10:100009795-100009817 GGAGCCGGGCGGGGGCCGGGCGG - Intronic
1073099617 10:100999833-100999855 GGCGGCGCGCGGGCCAGGGCCGG + Exonic
1073119153 10:101111059-101111081 GGGGCAGGGAGGGGCAAGGCGGG + Intronic
1073138036 10:101230309-101230331 GGCCCCGGCCGGGGCCCGGGCGG - Intergenic
1073465654 10:103693285-103693307 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1073493658 10:103872343-103872365 GGCACTGGGCTGGGCAGGGCAGG + Intergenic
1074772434 10:116742634-116742656 GGCGCCGGGCGGGCCGGGGCGGG - Intergenic
1075106260 10:119542168-119542190 AGCGCCCGGGGGAGCACGGCTGG - Intronic
1075106457 10:119542882-119542904 GTGCCCGGGCGGGGCAGGGCAGG + Intergenic
1075430399 10:122375123-122375145 GGCGCCCGGCGGGGGAGGGCGGG + Intronic
1075501734 10:122980721-122980743 GCCGCGGGGCGGGGCGGGGCGGG + Intronic
1075501738 10:122980726-122980748 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1075501741 10:122980731-122980753 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1075501744 10:122980736-122980758 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1075626760 10:123969467-123969489 GGCGCCTGGCTGGCCACGGAAGG - Intergenic
1075644210 10:124086935-124086957 GGCACTGGGTGGGGCAGGGCAGG - Intronic
1075802306 10:125160796-125160818 GGCGCGGGGCGGGCCCGGGCCGG - Intronic
1076035650 10:127196623-127196645 GGCGCGGGGCCGGGCCGGGCCGG + Intronic
1076322825 10:129596092-129596114 GGGGCAGGGAGGGGCAGGGCGGG - Intronic
1076678018 10:132158078-132158100 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1076678021 10:132158083-132158105 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1076721932 10:132396761-132396783 GGCGCAGGGCTGGGCCCGGAGGG + Intergenic
1076722205 10:132397566-132397588 GGCGCCGGGCCGGGGCGGGCCGG + Intronic
1076734701 10:132453345-132453367 GCCGCGGGGCGGGGCCCGGGGGG + Intergenic
1076737478 10:132465281-132465303 GGGGCAGGGCAGGGCAAGGCAGG - Intergenic
1076883830 10:133252369-133252391 GGTGCAGAGCGGGGCACGGTGGG - Intergenic
1076986113 11:236943-236965 GGCGCCGAGCGGCGCGGGGCAGG - Intronic
1077038589 11:507332-507354 GGGTCGGGGCGGGGCCCGGCGGG + Intergenic
1077079929 11:720754-720776 GGTGCCGGGCGGGGCAGGGTGGG + Intronic
1077107888 11:849798-849820 GGCGCGGGGCGGGGCGCGCGGGG + Intronic
1077140748 11:1023821-1023843 GGCGCCGGGCTGTGCCCTGCGGG - Intronic
1077185504 11:1233861-1233883 GGGGCAGGGCAGGGCAGGGCAGG - Intronic
1077185506 11:1233866-1233888 GGGGCGGGGCAGGGCAGGGCAGG - Intronic
1077185508 11:1233871-1233893 GATGCGGGGCGGGGCAGGGCAGG - Intronic
1077250451 11:1558464-1558486 TGCGGGGGGTGGGGCACGGCTGG + Intronic
1077316422 11:1921288-1921310 AGCGTCGGGCTGGGCACAGCAGG + Intronic
1077386355 11:2271235-2271257 GGAGCAGGGCGGGGCCCAGCAGG - Intergenic
1077419897 11:2445162-2445184 GGCGCCCGGCGGGGCAGCGCGGG + Exonic
1077495273 11:2884205-2884227 GGCGCGGGGCGCGGGCCGGCCGG + Intronic
1077867418 11:6234635-6234657 GGCGCGGGGCGGGGCGCGGCTGG - Exonic
1077898824 11:6474010-6474032 GGCGGCGGGCGGGGCGTGGGTGG - Intronic
1078057545 11:8019686-8019708 GGCGCCGGGAGGGGCGGGGCAGG + Intronic
1078164529 11:8870965-8870987 GGCGCCGCGCCCGGCCCGGCTGG - Intronic
1078190850 11:9091631-9091653 GGGGGCGGGCGGGGCCGGGCCGG - Intronic
1078375902 11:10792730-10792752 GCTGCGGGGCGGGGCAGGGCAGG + Intergenic
1078474775 11:11621299-11621321 CGCGCCGCGCGGGGCACTCCCGG + Intronic
1079090475 11:17476889-17476911 GGGGCTGGGCGGGGCCCGGGGGG - Intergenic
1079430871 11:20387526-20387548 GGCGCCGTGCGGGTCACGTGAGG - Exonic
1080045780 11:27806308-27806330 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1081705587 11:45180681-45180703 GGCGCTGGGCAGGGCCGGGCGGG + Intronic
1081811752 11:45918074-45918096 GGCGCTGGGCGGGTCAGGGGCGG - Intronic
1081994576 11:47355194-47355216 GAGGCCTGGCGGGGCCCGGCGGG + Exonic
1082035441 11:47642112-47642134 TCCGCCGGGCAGGGCAGGGCCGG + Intronic
1082701867 11:56441953-56441975 GGCACAGGACGGGGCAGGGCTGG + Intergenic
1083074280 11:60020391-60020413 GCCTCCTGGCGGGGCAGGGCTGG - Intergenic
1083560623 11:63670915-63670937 TGCCCAGGGCGGGGCTCGGCGGG + Intronic
1083657047 11:64234728-64234750 GGCGCGGGCCCGGGCGCGGCGGG - Exonic
1083758401 11:64803200-64803222 GGCGCGGGGCGGCGCGGGGCGGG + Exonic
1083764153 11:64834085-64834107 GGGGCAGGGCTGGGCACAGCAGG + Intronic
1083826628 11:65207570-65207592 GGGGCGGGGCAGGGCAGGGCAGG + Intronic
1083885633 11:65572299-65572321 GGGGCGGGGCGGGGCGCGGCGGG + Intronic
1083904791 11:65662669-65662691 GGCGCGGGGCGGGGCAGGCGGGG - Intronic
1083944982 11:65918816-65918838 GGCGGCGGGCGCGGCACGGCCGG - Intronic
1083945002 11:65918878-65918900 GGCGGCGGGAGGGGCAGGGCAGG - Intronic
1084010860 11:66347657-66347679 GGCGGCGCTCGGGGCTCGGCTGG - Exonic
1084010869 11:66347683-66347705 GGCGGCGGGCGGCGGGCGGCGGG - Exonic
1084010872 11:66347690-66347712 GGCGGCGGGCGGCGGGCGGCGGG - Exonic
1084028453 11:66467059-66467081 TGCGCCAGGCGGGCCCCGGCGGG + Intronic
1084083359 11:66843352-66843374 GGGCCCGGGCGGGGCGGGGCGGG + Intronic
1084146194 11:67266565-67266587 GGCGCCGAGCAGGGCCAGGCGGG + Exonic
1084165563 11:67373382-67373404 CGGGCCGGGGGAGGCACGGCTGG - Intronic
1084603578 11:70160349-70160371 TGGGCAGGGCGGGGCAGGGCAGG + Intronic
1086243151 11:84720510-84720532 GGCTCCGGGATGGCCACGGCGGG - Intronic
1086362061 11:86069364-86069386 GACGCCGGGCGGGGCGGGGCGGG + Intronic
1088823485 11:113475294-113475316 GGGGCGGGGCGGGGCGGGGCCGG + Exonic
1088889911 11:114036267-114036289 AGCGCCGGGCGGGACCCTGCTGG - Intergenic
1089009939 11:115123970-115123992 AGGGCAGGGCGGGGCAGGGCCGG - Intergenic
1089189612 11:116644438-116644460 GGCACAGGGAGGGGCATGGCAGG + Intergenic
1089346950 11:117796894-117796916 GGCCCCGGGTGGGGCGCAGCGGG - Intronic
1089543568 11:119205995-119206017 GGGGCGGGGCGGGGCCAGGCTGG - Intergenic
1089729521 11:120511673-120511695 GGCGCGGGGCGCCGCCCGGCGGG - Intergenic
1089800614 11:121024162-121024184 GGCGCCGGGCCGGGGCTGGCCGG + Exonic
1090211062 11:124921337-124921359 GGCGAGCGGCCGGGCACGGCGGG + Exonic
1090260337 11:125314727-125314749 GGGGCAGGGCAGGGCAGGGCAGG - Intronic
1090758510 11:129815786-129815808 GGAGCGGGGCGGGGCGCAGCGGG + Intergenic
1090784118 11:130033294-130033316 GGGGCCGCGCGGGGCATGCCGGG - Intergenic
1091225989 11:133956648-133956670 GGCGCCGGGAGGGGCAGGGGAGG + Intronic
1091266548 11:134276331-134276353 AGCGCAGCGCGGGGCACAGCGGG - Intronic
1091373370 12:11181-11203 GGCGCCGGGCTGGGGGCGGGGGG + Intergenic
1091616224 12:2053030-2053052 GGCGCTCGGCGCGGCGCGGCGGG + Intronic
1091712643 12:2752811-2752833 GGCGCGGGGTGTGGCGCGGCGGG + Intergenic
1091740761 12:2959251-2959273 GGGGCGGGGCGGGGCCGGGCCGG - Intergenic
1092184834 12:6471028-6471050 GGCGCGGGGTGGGGCAGGGGCGG - Intergenic
1092219048 12:6700551-6700573 GGAGCCGGGAAGGGCAGGGCCGG + Intronic
1092239574 12:6828644-6828666 GGCGCTGGGCCGGGTGCGGCTGG + Exonic
1092461981 12:8695196-8695218 GGGGCCGGGCGGGGCGGGGCGGG - Intronic
1094025740 12:25958641-25958663 GGGGCCGGGCCGGGCCGGGCCGG - Intergenic
1095206158 12:39442888-39442910 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
1096098930 12:48957211-48957233 AGTGCCGGGCGGGGCCCGGGAGG + Intronic
1096255057 12:50057743-50057765 GGAGCCGAGCGGGGCCGGGCGGG + Exonic
1096271180 12:50167373-50167395 GCCCCAGGGCGGGGCCCGGCCGG + Exonic
1097155074 12:57006462-57006484 CTCGTCGGGCCGGGCACGGCGGG - Intergenic
1097190365 12:57216694-57216716 GGGGGCGCGCGGGGCGCGGCCGG + Intergenic
1097191202 12:57220390-57220412 GGCGCGGGGCGGGGGGCGGGGGG + Intronic
1097284261 12:57865441-57865463 GGCGGCTGGCCGGGCAAGGCGGG + Intergenic
1097787785 12:63780062-63780084 GGCGCCGGCCGGGTCCCCGCGGG + Exonic
1097872083 12:64610367-64610389 CGCGCGGGGTGGGGCTCGGCCGG + Intergenic
1099202447 12:79691261-79691283 GGCCGCGGGCGGAGCGCGGCGGG - Intergenic
1101340966 12:103841388-103841410 GGGGCGGGGCGGGGCCGGGCCGG + Intergenic
1101371954 12:104138330-104138352 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1101504058 12:105330651-105330673 GTCCCCGGGCGGGGCGGGGCCGG + Exonic
1101750845 12:107581313-107581335 GGGGGCGGGCGGGGGGCGGCAGG + Intronic
1101966654 12:109286760-109286782 GGGGCAGGGCAGGGCAGGGCAGG + Intronic
1102157582 12:110743037-110743059 GGCGCTGGGCGGGGCGCAGATGG + Intergenic
1102278340 12:111599335-111599357 GGGGCCGGGCGGGGGAGGGGCGG + Exonic
1102278498 12:111599982-111600004 TGTGGCGGGCGGGGGACGGCAGG - Intergenic
1102471807 12:113163585-113163607 GGCGCAGAGAGGGGCAGGGCCGG - Intronic
1102570254 12:113823115-113823137 GGGGCGGGGCGGGGAGCGGCAGG - Intronic
1102646051 12:114404726-114404748 GATGCCGGGCGGGGGATGGCGGG + Intronic
1103379318 12:120481581-120481603 GGCATGGGGCGGGGCACAGCAGG + Intronic
1103698546 12:122835651-122835673 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1103775600 12:123364606-123364628 GGGGCCGTGCGGGGCCAGGCTGG - Intronic
1103779438 12:123389216-123389238 GGCGGCGCGCGGGGCCTGGCCGG + Intronic
1103800485 12:123534123-123534145 AGCGCCGGGCGGGGGAGGGGCGG - Intergenic
1103851581 12:123937033-123937055 AGCGCGGGGTGGGGCACGGCGGG + Exonic
1103856151 12:123972616-123972638 TGGGCTGGGCGGGGCGCGGCGGG + Exonic
1103938003 12:124486609-124486631 CGGGCATGGCGGGGCACGGCAGG + Intronic
1104734988 12:131131149-131131171 GGGGCTGGGCGGGGCACTGAGGG - Intronic
1104854331 12:131894962-131894984 GGCGCGGGGCGGGGGGTGGCGGG - Exonic
1104968586 12:132521003-132521025 GGCTCAGGGCAGGGCAGGGCAGG - Intronic
1105437873 13:20392208-20392230 TGCGCGGTGCGGGGCACTGCTGG - Intergenic
1105900440 13:24747646-24747668 GGCGCACGGCGGGGCACGGCGGG + Intergenic
1105943153 13:25169476-25169498 GGAGCAGGGCGGGGGACGGGTGG + Exonic
1106250493 13:27978550-27978572 GGGGCCGGGCGGGGCGGGGCGGG - Intronic
1106308341 13:28532638-28532660 GGGGTCGGGCGGGGACCGGCCGG + Intergenic
1106512348 13:30422290-30422312 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1106512351 13:30422295-30422317 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1106512376 13:30422345-30422367 TGCGCTGGGCGGGGCTGGGCTGG - Intergenic
1107058494 13:36131180-36131202 CTCGCCGGGCTGGGCGCGGCCGG + Exonic
1107086360 13:36431659-36431681 GGAGCCGGGCGGGGCAGGCGCGG + Intergenic
1107086552 13:36432382-36432404 GGGGCAGGGCGGGGAAGGGCAGG - Exonic
1107086557 13:36432392-36432414 CGGGCCGGGCGGGGCAGGGCGGG - Exonic
1107086575 13:36432427-36432449 GGGGCAGGGCGGGGCAGGGTTGG - Exonic
1109284879 13:60397642-60397664 GGCCCCGGGCGGCGGGCGGCGGG + Intronic
1110318445 13:74135067-74135089 GGCGGAGGGCCGGGCGCGGCAGG + Intergenic
1110367358 13:74701802-74701824 GGGGCAGGGCAGGGCAGGGCAGG - Intergenic
1110860641 13:80341527-80341549 GGGGCCGGGCTGGGCACTGCAGG + Intergenic
1111396226 13:87672427-87672449 GGAGCCGGGCGGGGCGGGGAGGG - Intergenic
1112494808 13:99896167-99896189 GGCTCCGGGCGGCCCGCGGCGGG - Exonic
1112621913 13:101061914-101061936 GGGGCAGGGCGGGGCGGGGCGGG + Intronic
1113082746 13:106535258-106535280 GGTGCCGGGCCGGCCGCGGCTGG + Intergenic
1113750436 13:112773207-112773229 GGGGCAGGGCAGGGCAGGGCAGG - Intronic
1113768401 13:112894480-112894502 GGCGCGGGGCGGAGCCGGGCAGG + Intronic
1113841570 13:113364191-113364213 GGGGCGGGGGGGGGCAGGGCGGG + Intergenic
1114549152 14:23523268-23523290 GGCGCCAGGCGAGGCAAGGTTGG + Exonic
1115610653 14:35046224-35046246 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1115610656 14:35046229-35046251 CGCGCGGGGCGGGGCGGGGCGGG - Intronic
1116018354 14:39432562-39432584 GCCGCGGGGCGGGGCGGGGCTGG + Intergenic
1116018358 14:39432567-39432589 GGGGCGGGGCGGGGCTGGGCGGG + Intergenic
1116018364 14:39432577-39432599 GGGGCTGGGCGGGGCGGGGCGGG + Intergenic
1116018369 14:39432587-39432609 GGGGCGGGGCGGGGCGGGGCTGG + Intergenic
1116018372 14:39432592-39432614 GGGGCGGGGCGGGGCTGGGCGGG + Intergenic
1116828338 14:49693386-49693408 GGCGCCGGGCGCGCCAGGCCTGG - Intronic
1118887513 14:69879353-69879375 GGGGCGGGGCGGAGCACGGCGGG - Intronic
1118932382 14:70254948-70254970 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932385 14:70254955-70254977 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932388 14:70254962-70254984 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932391 14:70254969-70254991 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932394 14:70254976-70254998 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932397 14:70254983-70255005 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932400 14:70254990-70255012 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932403 14:70254997-70255019 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1119236840 14:73026888-73026910 CGCGGCGGGCAGGGCAGGGCGGG - Intronic
1119290580 14:73491850-73491872 GGCGGCGGGCAGCGCGCGGCCGG - Exonic
1119392822 14:74302784-74302806 GGCGGCGGACGAGGCACGGAGGG + Intronic
1119539328 14:75428277-75428299 GGCGCCGGGACGGGCGGGGCGGG + Intronic
1120953360 14:90061727-90061749 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1120953363 14:90061732-90061754 GTCGCGGGGCGGGGCGGGGCGGG - Intergenic
1121042145 14:90758332-90758354 GGGGCGGGGCGGGGCGCGGCGGG + Intronic
1121050363 14:90816068-90816090 GGCGCGGGCAGGGGCGCGGCCGG - Intronic
1121168929 14:91836621-91836643 GAGGCAGGGCGGGGCAGGGCGGG + Intronic
1121308670 14:92923290-92923312 GGCACCGGGCGAGGGGCGGCTGG - Exonic
1121342771 14:93115320-93115342 GGAGCGGGGCGGGGCGCGGCGGG + Intronic
1121509423 14:94501338-94501360 GAGGCCGGGCAGGGCAGGGCTGG + Intronic
1121617060 14:95320093-95320115 GGCGAGGGGCGGGGCGGGGCGGG + Intergenic
1121617062 14:95320098-95320120 GGGGCGGGGCGGGGCGGGGCAGG + Intergenic
1121617065 14:95320103-95320125 GGGGCGGGGCGGGGCAGGGGCGG + Intergenic
1121645880 14:95516728-95516750 GCCACCGGGCGGGTCCCGGCGGG - Intronic
1122154695 14:99743058-99743080 GGCGCCGTGAGGGGCACTGAAGG - Intronic
1122208365 14:100159600-100159622 GGCGCCGTTCGGAGCGCGGCCGG + Exonic
1122220762 14:100238347-100238369 GGGGCCGCGCGGGGAGCGGCTGG - Intronic
1122230949 14:100306169-100306191 GGCGGCGGGCCGGGCCGGGCCGG - Intronic
1122310133 14:100789074-100789096 AGCACAGGGCGGGGCAAGGCCGG + Intergenic
1122316411 14:100828172-100828194 GGCGCGGGCCGGGGCGCCGCAGG + Intergenic
1122543375 14:102509720-102509742 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
1122543378 14:102509727-102509749 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
1122546817 14:102527703-102527725 GGGGCAGGGCAGGGCAGGGCAGG + Intergenic
1122582380 14:102778302-102778324 GGCGCCAGGCGGCTCTCGGCGGG + Intronic
1122768104 14:104085419-104085441 GGTGCGGGGCGGGGCCTGGCGGG - Intergenic
1122768115 14:104085441-104085463 GGTGCGGGGCGGGGCCTGGCGGG - Intergenic
1122768126 14:104085463-104085485 GGTGCGGGGCGGGGCCTGGCGGG - Intergenic
1122820475 14:104342231-104342253 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1122904495 14:104795565-104795587 GGCGCTGGGCGGGGCCGGGCTGG + Intronic
1122905624 14:104800387-104800409 GGCTGCGCGCGGGGCCCGGCCGG + Intergenic
1122917316 14:104865178-104865200 GGCGCGGGGTGCGGCGCGGCCGG + Intergenic
1122978687 14:105181497-105181519 GCCGCCGGGCGGGGCCAGCCGGG + Intergenic
1122985704 14:105210708-105210730 GGCTCCTGGCGGGGCGCGGGGGG - Intronic
1122989155 14:105228703-105228725 GCAGCCAGGCGGGGGACGGCAGG + Intronic
1123036902 14:105475237-105475259 GGCGCCGGGCGGGGCGGGGCAGG + Intronic
1123493234 15:20799481-20799503 ACCGCGGGGCGGGGCAGGGCGGG - Intergenic
1123549741 15:21368583-21368605 ACCGCGGGGCGGGGCAGGGCGGG - Intergenic
1123787465 15:23687404-23687426 GGGGGCGGGCGGGGCAGCGCGGG + Intergenic
1123869621 15:24557470-24557492 GGGGCCGGTCGGGGCGTGGCGGG - Intergenic
1124120386 15:26883561-26883583 AGCGCCGGGCGGGGGCGGGCGGG + Intronic
1124345593 15:28919520-28919542 GGGGCCGGCAGGGGCACAGCTGG + Intronic
1124354316 15:28983949-28983971 GGGGCAGGGCAGGGCAGGGCAGG - Intronic
1124453655 15:29821869-29821891 GGCGGCGGGGTGGGCAGGGCTGG - Intronic
1125536155 15:40441867-40441889 CGCGCCGGGCCGGGGGCGGCAGG + Intronic
1126113265 15:45187683-45187705 GGCGGCGCGGGGGGCGCGGCCGG + Intronic
1126163515 15:45634926-45634948 GGCGCCGGGCGGGGCACGGCGGG + Exonic
1126823658 15:52528906-52528928 GGAGCAGGGCAGGGCAGGGCCGG + Exonic
1126823677 15:52528940-52528962 CGCGCGGGGCGGGGCGGGGCGGG + Exonic
1126940385 15:53759712-53759734 GGGGCGGGGCGGGGCGAGGCGGG - Intronic
1127221751 15:56887429-56887451 GGGGGCGGGCGGAGCAGGGCCGG + Intronic
1127257869 15:57306911-57306933 GGCGCGGGGCTGGGCAGTGCCGG - Intergenic
1127674828 15:61228986-61229008 GGCGCGGAGCGGGGGGCGGCCGG - Intronic
1127922427 15:63504298-63504320 GGCGCCGAGCAGGGCACCCCGGG - Intergenic
1128392389 15:67191027-67191049 GGGGCGGGGCGGGGCTGGGCTGG - Exonic
1128392391 15:67191032-67191054 GGGGCGGGGCGGGGCGGGGCTGG - Exonic
1128605225 15:69031910-69031932 GGGGAGGGGCGGGGCAGGGCGGG - Intronic
1129162215 15:73753155-73753177 GGAGCCCGGCGGGGCAGGGCAGG - Intergenic
1129200335 15:73994845-73994867 GGGGCCGGGCGGGGTCCTGCTGG - Exonic
1129780140 15:78264594-78264616 GGCGCGGGGCGGGGGGCGGGCGG + Intronic
1129854039 15:78811543-78811565 GGGGCCGGCCGGGGCGGGGCGGG - Intronic
1129948244 15:79560605-79560627 GGCGCGGGCCGGGGCCAGGCCGG + Intergenic
1129986363 15:79923110-79923132 GGCGCCGGGCGGGGCTGGGCGGG - Intronic
1130531009 15:84748227-84748249 GGAGCCGGGCGGGGGCCGGCCGG + Intergenic
1130564430 15:84981711-84981733 GGAGCGGGGCCGGGCGCGGCCGG + Intronic
1131097459 15:89665677-89665699 GGCTTCTCGCGGGGCACGGCCGG + Exonic
1131112964 15:89776843-89776865 GGCCACGGTCGGGGCACAGCGGG - Exonic
1131171909 15:90184889-90184911 GGGGCTGGGCGGGGCTTGGCGGG + Intronic
1131378032 15:91941276-91941298 GGGGCAGGGCGGGGCTCGGCTGG + Intronic
1131827035 15:96330459-96330481 GGCGCGGCGCGGGGCACGCGGGG - Intronic
1131827413 15:96332184-96332206 GGCGGCGGGCCGGGCACGGGCGG - Exonic
1132055637 15:98648849-98648871 GGCGGCGGGCGGGGGCCGGGCGG + Intergenic
1132090711 15:98946194-98946216 GGGGCGGGGCGGGGCAGGGGTGG + Intronic
1132128438 15:99251461-99251483 GACGGCGGGCGGGGCGGGGCAGG - Exonic
1132178479 15:99733576-99733598 GGCTCGGGGCGGGGCTCGACAGG + Intergenic
1132426814 15:101724560-101724582 GGCGCTGGGCGGGGAGGGGCGGG + Exonic
1132426834 15:101724604-101724626 GGGGCGGGGCGGGGCGGGGCGGG + Exonic
1202958072 15_KI270727v1_random:95801-95823 ACCGCGGGGCGGGGCAGGGCGGG - Intergenic
1132478506 16:154150-154172 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1132480620 16:164793-164815 GTCGCGGGGCGGGGCGGGGCGGG + Intronic
1132480623 16:164798-164820 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1132480626 16:164803-164825 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1132480643 16:164836-164858 GGGGCCCGGCGGGGCGGGGCGGG + Intronic
1132480670 16:164883-164905 GGCGCGGGGCGGGGCGGGCCGGG + Intronic
1132480701 16:164941-164963 GGCGCGGGGCGGGGCGGGGCGGG + Intronic
1132498857 16:275947-275969 GGCGCGGGGCGGGGCCGGGCGGG - Intronic
1132498860 16:275952-275974 GGCGCGGCGCGGGGCGGGGCCGG - Intronic
1132512745 16:352449-352471 CGCGGCGGGCGGGACCCGGCGGG + Exonic
1132519983 16:382385-382407 CGCGCCGGGCGGGGCAGGGCAGG - Intronic
1132552889 16:560579-560601 GGCGCGGGGCGGGGAGGGGCGGG + Exonic
1132557506 16:579017-579039 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1132557508 16:579022-579044 GGGGCGGGGCGGGGCGGGGCCGG + Intronic
1132564788 16:616982-617004 CGGGCAGGGCGGGGCAGGGCAGG - Intronic
1132583442 16:695376-695398 CGCGCCGGGCGGGGCTGGGCCGG - Intronic
1132589739 16:721436-721458 GGTGCGGGGCGGGGCCAGGCCGG + Exonic
1132591579 16:728486-728508 GTCGCCTGGCGGGGGAGGGCGGG - Exonic
1132641811 16:981589-981611 GGCGCCGGGCGGGGCAGGCGGGG + Intergenic
1132683475 16:1153074-1153096 GGGGCGGGGCGGGGCGGGGCCGG - Intergenic
1132683477 16:1153079-1153101 GGCGGGGGGCGGGGCGGGGCGGG - Intergenic
1132694353 16:1195301-1195323 GGCTCAGGGCGGGGCAGGGGCGG + Intronic
1132719773 16:1309873-1309895 GGCGCGGGGCCCGGCTCGGCGGG - Intronic
1132885046 16:2178876-2178898 GGTGCGGGGCGGGGCCTGGCGGG - Intronic
1132946043 16:2531983-2532005 GAGGCTGGGCGGGGCGCGGCCGG - Intergenic
1132947049 16:2537730-2537752 GGGGCTGGGCGGGGCTGGGCGGG - Intergenic
1132978346 16:2721383-2721405 GGCGCGGGGCGCGGCGCGGGCGG + Intergenic
1133020617 16:2965181-2965203 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1133102295 16:3486712-3486734 GGCGCTGAGCTGGGCCCGGCAGG - Exonic
1133116184 16:3579182-3579204 GGGGCGGGGCGGGGCTGGGCTGG - Intergenic
1133116186 16:3579187-3579209 GGGGCGGGGCGGGGCGGGGCTGG - Intergenic
1133188525 16:4116585-4116607 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1133286744 16:4694248-4694270 GGCGGGGGGCGGGGCCCGGGCGG - Intronic
1133784556 16:8963988-8964010 AGCGCAGGGCGGAGCACGGGAGG + Intronic
1135240856 16:20806328-20806350 GCCGCAGAGCAGGGCACGGCAGG - Intronic
1136398483 16:30005462-30005484 GGCGCCGGGCGGGGCCGTGGTGG - Exonic
1136627684 16:31472110-31472132 GGCGGGGGGCGGGGGACGTCCGG - Exonic
1136853712 16:33635333-33635355 GGAGCAGGGCAGGGCAGGGCAGG - Intergenic
1137300528 16:47144025-47144047 GGCGCGGGGCGGGGCGGGGCGGG - Intergenic
1137300531 16:47144030-47144052 GGCGCGGCGCGGGGCGGGGCGGG - Intergenic
1137988785 16:53131479-53131501 GGCGCGGGGCGGGCCGCGGGCGG - Intronic
1138105880 16:54286942-54286964 CGCGCGGGGCGGGGCGGGGCAGG + Intergenic
1138105883 16:54286947-54286969 GGGGCGGGGCGGGGCAGGGGCGG + Intergenic
1138265319 16:55656111-55656133 GCCGCCGGTCGGGGGCCGGCAGG + Intronic
1138351383 16:56347904-56347926 GGGGCAGGGTGGGGGACGGCGGG - Exonic
1138472053 16:57245496-57245518 GGGGCCGGGCCGGGCCGGGCCGG + Intronic
1138619078 16:58197720-58197742 GCGGCCGGGCCGGGCATGGCGGG + Exonic
1138660871 16:58516125-58516147 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1138660874 16:58516130-58516152 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1139778291 16:69330609-69330631 GCCGCAGCGCGGGGCACGCCGGG + Intronic
1140481683 16:75265773-75265795 GCAGCCGGGCGGGGGACAGCCGG + Intronic
1141054596 16:80803957-80803979 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1141132331 16:81444892-81444914 GGCGCCGGGGTGGGGGCGGCGGG - Intergenic
1141531226 16:84648443-84648465 GGGGCCGGGCGGCGCGGGGCGGG - Intergenic
1141608610 16:85169329-85169351 GCCGCCGGGGGGTGCTCGGCAGG + Intergenic
1141682273 16:85551558-85551580 GGCTCACGGCGGGGCACGGTGGG + Intergenic
1141694228 16:85612242-85612264 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1141959183 16:87392804-87392826 GGCGGTGGCCGGGGTACGGCAGG - Intronic
1142022319 16:87791577-87791599 GGCGCCGGGCGGGCCTCCGCAGG - Intergenic
1142052143 16:87965612-87965634 GGGGCTGGGCGGGGCTGGGCGGG + Intronic
1142130871 16:88430938-88430960 GGAGCCGGGCGGGTCTCGCCCGG + Exonic
1142177227 16:88650838-88650860 GGCGCCAGGCGGGCCAGGCCGGG - Intronic
1142290952 16:89193366-89193388 GGGGCGGGGCGGGGCAAGGCTGG - Intronic
1142349881 16:89575185-89575207 GGGGCGGGGCGGGGCAGGCCTGG - Intergenic
1142367566 16:89657999-89658021 GGCCCAGGGCGGGGCTGGGCTGG + Intronic
1142467401 17:144093-144115 GGCGGCGGGCGGGGCGGCGCTGG + Intergenic
1142509420 17:385028-385050 GGTGTCGGGCGGGGCGGGGCGGG + Intronic
1142559691 17:802745-802767 GGTGCTGGGCTGGGCAGGGCCGG + Intronic
1142610903 17:1108890-1108912 GGCGCTGGGGGGGGCCGGGCCGG - Intronic
1142699139 17:1649088-1649110 GGCGCTGGGCGGGGCTCCGGGGG - Intronic
1142699156 17:1649129-1649151 GGCGCTGGGCGGGGCTCCGGGGG - Intronic
1142762482 17:2050434-2050456 AGCGCCGGGCGGGGCAGGGCGGG - Intergenic
1142810614 17:2393959-2393981 AGGGCGGGGCGGGGCGCGGCCGG + Intronic
1142836760 17:2593508-2593530 TGCGCCGGGCTGGGCCGGGCCGG - Intronic
1142860017 17:2755703-2755725 GCGGCCGGGCGAGGCATGGCGGG + Intergenic
1143016344 17:3893001-3893023 GGGGCGGGGCGGGGCGGGGCGGG - Exonic
1143150171 17:4802663-4802685 GGCGCCAGGCTGGACACCGCTGG + Intergenic
1143462472 17:7112720-7112742 GGTGCTGGGCAGGGCAGGGCAGG - Intronic
1143479466 17:7220152-7220174 GCCGCCGGGCAGGGCCGGGCCGG - Exonic
1143515215 17:7416120-7416142 GGGGCTGGGCGGGGCTGGGCGGG + Intronic
1143527202 17:7479558-7479580 GGCGCTGGGGGGGCCAGGGCCGG - Intronic
1143565287 17:7717202-7717224 GGCGCGGGGCGGGGAAAGGGAGG - Intergenic
1143590753 17:7884964-7884986 GGCGCGGGCCGGGCCACGACCGG + Exonic
1144693010 17:17281097-17281119 GCCGCCGGGCTGGGCATGGGCGG - Intronic
1144784356 17:17823655-17823677 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1144847162 17:18225880-18225902 GGCGCGGGGCGGGGCCGGGCCGG + Intronic
1145034961 17:19534281-19534303 GGGGCCCCGCGGGGCACTGCGGG + Intronic
1145077356 17:19867302-19867324 AGCGCCGGCCGGGGCGAGGCCGG - Intronic
1145846340 17:28042011-28042033 GGAGGCGGGCGGGGTACGGTCGG - Intronic
1146053015 17:29567493-29567515 GGGGCCGGGCGGGGGAGAGCAGG - Intronic
1146398571 17:32487051-32487073 GGCGCTCGGCGGGGATCGGCTGG - Exonic
1147184271 17:38705234-38705256 GGCGCGGGGCGGCGCGGGGCGGG + Intergenic
1147264383 17:39225885-39225907 GGTGCCGGGCTGGGGCCGGCGGG - Intergenic
1147606412 17:41776149-41776171 GGAGCAGGGCGGAGCAGGGCAGG + Intronic
1147657369 17:42098493-42098515 GGGGCCCGGCGGGGCAGGGGCGG + Intergenic
1147996792 17:44363927-44363949 GGCGGCGGGCGGAGCGGGGCCGG - Intergenic
1148406823 17:47423533-47423555 GGCACCGTGCCTGGCACGGCCGG - Intronic
1148807855 17:50273273-50273295 GGAGCCGGGAGGGGCGCGGCCGG - Intronic
1148878562 17:50707688-50707710 GGCCCCGGGCGGGGCGGGGCAGG - Exonic
1149475915 17:56960746-56960768 GGCGCAGGGAGCGGGACGGCCGG - Intronic
1149610573 17:57955471-57955493 GGCTGCGGGCGGGGCGGGGCGGG + Intergenic
1149643325 17:58219333-58219355 GGCGCCGTGACGGGAACGGCGGG - Intronic
1149849915 17:60028236-60028258 GGCCCAGGGAGGGGCAGGGCTGG + Intergenic
1149860253 17:60118288-60118310 GGCCCAGGGAGGGGCAGGGCTGG - Intergenic
1150133314 17:62680718-62680740 GGAGGCGGGCGCGGCAGGGCCGG - Intronic
1150225558 17:63523001-63523023 GGGGCGGGGCGGGGCGGGGCTGG - Intergenic
1150225560 17:63523006-63523028 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1150225563 17:63523011-63523033 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1150250064 17:63700168-63700190 GGCGCGGGGCGGGGGCCGGCGGG - Intronic
1150561918 17:66302319-66302341 GGCGGCGGCCGGGGGAGGGCCGG - Intergenic
1151224866 17:72640575-72640597 GGCGCCGGGCGTGGCGCCGGGGG - Intergenic
1151301628 17:73231677-73231699 GGCACCGGGCGGGGAGCTGCCGG - Intronic
1151783741 17:76265287-76265309 AGCGCGGGGCGGGGCTGGGCCGG - Exonic
1152083839 17:78205387-78205409 GGCTCCAGGCGGAGCAAGGCAGG - Intronic
1152111509 17:78359825-78359847 GGCGCAGCGCGGGCCACCGCTGG - Exonic
1152433111 17:80260522-80260544 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433124 17:80260552-80260574 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433137 17:80260582-80260604 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433150 17:80260612-80260634 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433163 17:80260642-80260664 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433176 17:80260672-80260694 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433189 17:80260702-80260724 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433202 17:80260732-80260754 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433215 17:80260762-80260784 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433228 17:80260792-80260814 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152637766 17:81437154-81437176 GCAGCTGGGCGGGGCAGGGCGGG - Intronic
1152728147 17:81957782-81957804 TGGGCAGGGCGGGGCAGGGCTGG - Intronic
1152742105 17:82022930-82022952 GGCGCGGGGCGGGGCTCCGGGGG - Intronic
1152742226 17:82023358-82023380 GGCTGCAGGCGGGGCAGGGCTGG + Exonic
1152926050 17:83088266-83088288 GGCACAGGTCTGGGCACGGCCGG - Intronic
1153855089 18:9137210-9137232 GGCGGCGGGCGGGGCCCCGGCGG - Intronic
1153855125 18:9137290-9137312 GGCGCTGCGCGGGGCGGGGCGGG + Intronic
1153900681 18:9614679-9614701 GGGGCGGGGCGGGGCGCGGCCGG - Intronic
1154241602 18:12658118-12658140 GGCGCGAGGCGGGGCGGGGCGGG - Exonic
1154304053 18:13217991-13218013 GGCGCTGTGCGGGGCGCGGCAGG - Intronic
1154358861 18:13642631-13642653 GAGGCCGGGCAGGGCACGGGCGG + Intronic
1154450786 18:14474018-14474040 ACCGCGGGGCGGGGCAGGGCGGG - Intergenic
1155229171 18:23756946-23756968 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1155474821 18:26227008-26227030 GGCCCCGGCCGGGGCGCTGCCGG + Exonic
1155654530 18:28177834-28177856 GGCGCAGGGCGAGGACCGGCGGG - Intergenic
1156377998 18:36531903-36531925 GGTGCTGGGCTGGGCAGGGCAGG - Intronic
1157279416 18:46335742-46335764 GGCGCGGGGCTGGGGACAGCTGG - Intronic
1157610007 18:48950249-48950271 GGCGGCGGCCCGGGCAGGGCTGG - Exonic
1157867141 18:51197071-51197093 GGCGCAGGGCCAGGCCCGGCGGG - Exonic
1158478825 18:57803208-57803230 GACGCGGGGCGGGGAAAGGCGGG - Intergenic
1158592489 18:58789571-58789593 GGCTCTGGGCTGGGCAGGGCTGG - Intergenic
1159246067 18:65807104-65807126 GGGGTGGGGTGGGGCACGGCTGG + Intronic
1159586594 18:70288830-70288852 GGGGCCGCGCGGGGCGGGGCGGG - Intergenic
1159969153 18:74627818-74627840 GGGGCGGGGCAGGGCAGGGCAGG - Intronic
1159969155 18:74627823-74627845 GGGGTGGGGCGGGGCAGGGCAGG - Intronic
1159969165 18:74627843-74627865 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1160204658 18:76822747-76822769 GGCGCCGGGAGCGGCGGGGCGGG + Intronic
1160447211 18:78936906-78936928 GGAGACGGGCAGGGCAGGGCTGG + Intergenic
1160453346 18:78979753-78979775 GGCGGCGGGGGGGGCGCGGGCGG + Intergenic
1160704606 19:524195-524217 GGAGCTGGGCGGGGCAGGGGAGG - Intergenic
1160753580 19:746861-746883 GGCGCCGGGAGGGGCCGGGCTGG - Exonic
1160788702 19:913058-913080 GCGGGCGGGCGGGGCGCGGCGGG - Intronic
1160860415 19:1235171-1235193 GGCCCCGGGCGGGCCACGCCAGG + Intronic
1160860418 19:1235175-1235197 GGCGCCTGGCGTGGCCCGCCCGG - Intronic
1160860896 19:1236913-1236935 GCGCCCGGGCTGGGCACGGCGGG - Intronic
1160895424 19:1400004-1400026 GGCACAGGGCAGGGCAGGGCTGG + Intronic
1160904585 19:1446245-1446267 GCCGAGGGGCGGGGCGCGGCGGG + Intergenic
1160930676 19:1568222-1568244 GGGGCCGGGCCGGGCCGGGCCGG + Intergenic
1160940501 19:1618492-1618514 GGGGGAGGGCGGGGCAGGGCAGG - Intronic
1160947801 19:1651811-1651833 GGCGCTGGTCGGGGCCGGGCGGG - Intronic
1160948122 19:1652671-1652693 GCCGCCGGGCGGGGCACTCGGGG - Intergenic
1161014918 19:1978754-1978776 CGCGGCGGGCGGGGCGGGGCGGG + Intronic
1161014922 19:1978764-1978786 GGGGCGGGGCGGGGCTCGGAGGG + Intronic
1161032553 19:2064886-2064908 GGCGGCGGGTGGGGCAGCGCGGG + Intergenic
1161045608 19:2132806-2132828 GGAGCCGGGATGGGCGCGGCTGG + Intronic
1161067233 19:2244631-2244653 GGCTCCGGGCGGCTCGCGGCGGG + Intronic
1161120202 19:2521488-2521510 GGGGCCGTCCGGGGCACTGCAGG - Intronic
1161153581 19:2721420-2721442 GGCGGAGCGCGGGGCCCGGCGGG - Intronic
1161153589 19:2721442-2721464 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1161153592 19:2721447-2721469 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1161175883 19:2841877-2841899 GGCCCCGGGCGGGGCGTGGGGGG - Intronic
1161304162 19:3557614-3557636 TGCGCCGGGCGGGGCAGGGCGGG + Intronic
1161319331 19:3633724-3633746 TTGGCGGGGCGGGGCACGGCGGG + Intronic
1161390350 19:4017301-4017323 GGAGCTGGGCTGGGCAGGGCAGG - Intronic
1161509382 19:4662152-4662174 AGCGCCCCGCAGGGCACGGCGGG + Intronic
1161581730 19:5084849-5084871 GGCGGCGGGCGGGGGAGGGTGGG - Intronic
1161735606 19:5990542-5990564 GGGGCGGGGCGGGGCAATGCGGG + Intergenic
1161851371 19:6739635-6739657 GGGGCCGGGCGGGGCGGGGCGGG + Intronic
1161851396 19:6739696-6739718 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
1161925240 19:7294495-7294517 GGAGGCGGGCGGGGCGGGGCGGG - Intergenic
1161973401 19:7596180-7596202 GGCGGCGGGCCGGGCGCGGCAGG + Intronic
1162200754 19:9018373-9018395 GGACCGGGGCGGGGCATGGCCGG - Intergenic
1162235961 19:9309736-9309758 AGGGCGGGGCGGGGCAGGGCAGG + Intronic
1162327876 19:10009509-10009531 GGCGCAGGGCGGGGCAGGAGTGG - Intronic
1162421637 19:10568890-10568912 GGCGCCGGGCAGGGCCCCGCGGG - Exonic
1162471020 19:10871974-10871996 GGCCCGGGGCGGGGGCCGGCGGG + Intronic
1162561314 19:11419402-11419424 GGGGCGGGGCGGGGCAGGGCAGG + Intergenic
1162798150 19:13097117-13097139 CGCGCAGGGCGGGGCAGGCCCGG - Intronic
1162806349 19:13139676-13139698 GGGGCTGGGCAGGGCAGGGCAGG + Exonic
1162809064 19:13153512-13153534 GGCGGGGCGCGGGGCACAGCAGG - Exonic
1162932477 19:13963832-13963854 AGCGCGGGGCGGGGCGGGGCGGG - Intronic
1163102572 19:15107324-15107346 GGCGCGGGGCGGGGGGCGGGCGG + Intergenic
1163167620 19:15508695-15508717 GGCGGCGGGCGGGGCGCAGCCGG + Intronic
1163424878 19:17235858-17235880 GGCGCAGGGGGCGGCGCGGCGGG - Exonic
1163442421 19:17328675-17328697 GGCGGCGGGCGGGGGAAGGCGGG - Exonic
1163695156 19:18760216-18760238 GGCGCCGGCCAGGGTAAGGCAGG + Exonic
1163715312 19:18869567-18869589 GGCGCCCTGCGGGGTGCGGCGGG + Intronic
1164156921 19:22602710-22602732 GGCGGAGGCCAGGGCACGGCAGG + Intergenic
1164643844 19:29844486-29844508 GACGCGGGGCGGGGCGGGGCGGG - Intergenic
1164722744 19:30444307-30444329 GGCACCGGGTGGGCCACGTCGGG - Exonic
1164952188 19:32345884-32345906 AGCACCGGGCGGGGGTCGGCCGG - Intronic
1164952715 19:32351528-32351550 GGGGGCGGGCGGGGCCTGGCAGG + Intronic
1165040237 19:33063809-33063831 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
1165040240 19:33063816-33063838 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
1165065732 19:33226832-33226854 GGCGGCGGGCGGGGCGAGCCTGG + Intergenic
1165172854 19:33906097-33906119 GAGGCCGGGCGGGGCGGGGCGGG + Intergenic
1165227476 19:34365133-34365155 GGGGCCGGGCCGGGCCGGGCCGG + Intronic
1165242898 19:34481841-34481863 GGCGCGGGGCGGGGCGGGGCCGG - Exonic
1165305476 19:35000430-35000452 GGCGCAGGGCAGGGCAGGGCAGG - Exonic
1165426410 19:35748330-35748352 TGCGCCGCGCGGGGCACGGTGGG - Intronic
1165763475 19:38336085-38336107 GGCGAAGGGCGGGGCGGGGCAGG + Intronic
1165792120 19:38499016-38499038 GCCGCAGGGCAGGGCAGGGCAGG + Intronic
1165832282 19:38735873-38735895 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1165832285 19:38735878-38735900 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1165832302 19:38735908-38735930 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1165832332 19:38735963-38735985 GGGGCGGGGCGGGGCGGGGCAGG + Intronic
1166215337 19:41331026-41331048 GGGGCGGGGCGGGGCGGGGCGGG + Exonic
1166354757 19:42220393-42220415 GGCGCCGCGCGGGGCTGGACTGG + Intronic
1166721809 19:45001437-45001459 GGCGCGGGGCCGGGCCGGGCGGG - Exonic
1166731971 19:45064322-45064344 GGCTGCAGGCGGGGCACGGAGGG - Exonic
1166746670 19:45145076-45145098 CGCGCCTGGGGGGGCACCGCAGG - Exonic
1166981460 19:46634464-46634486 GGCAAGGGGCGGGGCAGGGCAGG - Intronic
1167001128 19:46746297-46746319 GCCCCCGGGCCGGGCCCGGCAGG - Exonic
1167072978 19:47231238-47231260 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1167258156 19:48443155-48443177 GGCGGCGCGGGGGGCACGGGGGG + Exonic
1167310599 19:48735483-48735505 GGCGTCGGGTGGGGCAGCGCTGG - Exonic
1167357047 19:49010628-49010650 GGGGCAGGGCAGGGCAGGGCAGG - Intronic
1167376302 19:49114222-49114244 GGCGGAGGGCAGGGCGCGGCTGG + Intergenic
1167454540 19:49591475-49591497 GGCCCCGGGCGGGGGAGGGAGGG - Intergenic
1167463892 19:49640138-49640160 GGAGCCGGGCGGGACCCGGGGGG + Exonic
1167775758 19:51553557-51553579 GGAGCCGGGAGGGGCACAGAGGG - Intergenic
1167990690 19:53358302-53358324 GGGGCTGGGCTGGGCAGGGCGGG - Intergenic
1167990695 19:53358312-53358334 GGGGCGGGGCGGGGCTGGGCTGG - Intergenic
1168297285 19:55383696-55383718 AGGGGCGGGCGGGGCAGGGCGGG - Intronic
1168459036 19:56538768-56538790 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1168459039 19:56538773-56538795 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1168459042 19:56538778-56538800 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1168459045 19:56538783-56538805 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1168459048 19:56538788-56538810 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1168459051 19:56538793-56538815 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1168459054 19:56538798-56538820 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1168459057 19:56538803-56538825 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1168459060 19:56538808-56538830 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1168459078 19:56538846-56538868 GGGGAGGGGCGGGGCGCGGCCGG + Intergenic
925018753 2:552402-552424 GGCGGTGGGTGGGGCAGGGCTGG - Intergenic
925069620 2:956231-956253 GGGGCGGGGCGGGGCAGGGGTGG - Intronic
925131370 2:1496341-1496363 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
925927637 2:8681783-8681805 GGCGGGGGGCGGGGAGCGGCGGG - Intronic
925959795 2:9003860-9003882 GGCGCCGGGGCGGGGACGACGGG - Intergenic
926018447 2:9474541-9474563 GCAGCCGGGCGGGGCGGGGCGGG - Exonic
926325828 2:11784596-11784618 GGCGCCTGGAGGGGAAGGGCAGG + Intronic
927125967 2:20012615-20012637 GGGGCCGGGCGCGGCATGGTGGG + Exonic
927652277 2:24919984-24920006 GGGGCCGTGCGGGGGCCGGCAGG + Intergenic
927938149 2:27086723-27086745 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
927938152 2:27086728-27086750 GGGGCGGGGCGGGGCGGGGCGGG + Exonic
927956064 2:27208150-27208172 GGCGCCAGGCTGGGCTCTGCTGG - Intronic
928546640 2:32334944-32334966 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
928546643 2:32334949-32334971 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
928546646 2:32334954-32334976 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
928606332 2:32947539-32947561 GACCCCGGGGGAGGCACGGCTGG - Exonic
929779804 2:44950099-44950121 TGTGCCGGGCGGGGCTCGGCGGG + Intergenic
929808428 2:45169063-45169085 GACGGCAGGCGGGGGACGGCAGG + Intergenic
930284889 2:49415264-49415286 GGTGGGGGGCGGGGGACGGCGGG + Intergenic
930358234 2:50346903-50346925 GGCGCCGAGCTGGGCTCGCCCGG - Intronic
931348950 2:61471221-61471243 GGCGGCGAGCCGGCCACGGCGGG - Intergenic
932190985 2:69741707-69741729 GGCGCGGAGCTGGGCGCGGCAGG + Intronic
932496701 2:72149087-72149109 GGCGGCGGGCGGCGGGCGGCCGG - Intergenic
932567145 2:72917430-72917452 GGGGCGGGGCGAGGGACGGCGGG - Intronic
932635597 2:73385700-73385722 GACGCCGCGCGAGGCCCGGCGGG - Intergenic
932779179 2:74549333-74549355 GGCGCCGGGCGGAGCAGGCCGGG - Intronic
933278220 2:80304614-80304636 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
933684675 2:85133610-85133632 GGCGCCGGGCCGGGCCGGGCAGG + Exonic
933728065 2:85437646-85437668 GGCGTCGGGCGGCGCAGGGCAGG + Intergenic
934079122 2:88452470-88452492 GGCGGCGGGCGGGGGCAGGCCGG + Exonic
934566923 2:95346438-95346460 CGTGCCGGGCGGGGCGGGGCCGG + Intronic
935137620 2:100321703-100321725 GGCGCCCGGCGAGGGAGGGCCGG - Exonic
935590390 2:104842649-104842671 CGCGCAGGGCAGGGCAGGGCAGG - Intergenic
936038401 2:109129991-109130013 GGCGGCGGGGGCGGCGCGGCAGG + Exonic
936512154 2:113157325-113157347 GGCGCAGGGCGGGGAGGGGCGGG - Intronic
937018937 2:118633081-118633103 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
937018940 2:118633086-118633108 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
937907429 2:127059035-127059057 GGCCCCGGGCGTGGCCCCGCCGG + Exonic
938258380 2:129877838-129877860 GGCGCGGGGGCGGGCACAGCAGG + Intergenic
938727283 2:134120119-134120141 GCCGCCGAGCGGGCCGCGGCAGG - Intronic
939375458 2:141359762-141359784 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
940774939 2:157875871-157875893 GGCGCGGGGCGGCGCGGGGCGGG + Intergenic
941730638 2:168913353-168913375 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
941901863 2:170686401-170686423 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
942084101 2:172428128-172428150 CGCGCGGGGCGGGTCAGGGCGGG - Intronic
942084105 2:172428133-172428155 GGCGCCGCGCGGGGCGGGTCAGG - Intronic
942965776 2:181891666-181891688 GGGGCCGCGCGGGGCGCGGTAGG - Intergenic
944114290 2:196171102-196171124 GGCTCCGCGCGGGGGGCGGCCGG - Intronic
945225846 2:207530390-207530412 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
945955414 2:216081869-216081891 GCCGGCGGGCGGGGCGGGGCCGG - Exonic
946311197 2:218883532-218883554 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
946311228 2:218883603-218883625 CGCGTCGGGCTGGGCTCGGCCGG - Intronic
946340043 2:219060791-219060813 GCCGCCGGGCTGGGCTGGGCTGG + Intergenic
946351785 2:219160276-219160298 GGGACCGGGCGGGGCCCAGCCGG - Intronic
946386714 2:219388098-219388120 GGCGAGGGGCGGGGCGGGGCGGG - Intronic
946404204 2:219483990-219484012 GGCGCTGGGCCGTGCAGGGCTGG - Exonic
946431084 2:219627748-219627770 ACCGCGGGGCGGGGCACGCCGGG + Intronic
946622370 2:221573334-221573356 GCAGCCGGGCGGGGCTCTGCGGG - Intronic
946865510 2:224038825-224038847 GGACCCGGGCAGGGCAAGGCGGG - Intronic
947742933 2:232493103-232493125 GGCTCCGGGCTGGGCACTGGGGG - Intergenic
947935344 2:233999145-233999167 GGGGCAGGGCAGGGCAGGGCAGG + Intronic
948115877 2:235494141-235494163 GTCGGCGGGCGGCGCACGGCGGG + Exonic
948142441 2:235683849-235683871 GGGGCCGGGCGGGGGACGGGGGG - Intronic
948645217 2:239400421-239400443 GGCGCGGGGGTGGGCACGGCAGG - Exonic
948755285 2:240155868-240155890 TGGGCCGGGCTGGGCACTGCAGG + Intergenic
948801515 2:240435548-240435570 AGCACCGGGCGGGGCGGGGCGGG - Intergenic
948824215 2:240566565-240566587 GGGGCGGGGCGGGGCGGGGCCGG + Intronic
948824626 2:240568356-240568378 GGCGCCGGGCGGGGAGGGCCAGG - Intronic
948828679 2:240586796-240586818 TGGGCCGGGCGGGGAACGGGCGG + Exonic
948901418 2:240958571-240958593 GGCGGCTGGCGGGGGGCGGCTGG - Intronic
948915667 2:241034083-241034105 GGGGCAGGGCGGGGCAGGTCAGG - Intronic
948958789 2:241315876-241315898 CGCGCTGGGCGGGGCGGGGCGGG + Exonic
1168883395 20:1226010-1226032 GGCGCGGGGCGGGGAGGGGCGGG - Intergenic
1168965166 20:1894511-1894533 GGCGCAGGTCCGGGCCCGGCAGG + Exonic
1169214799 20:3786674-3786696 GTCGCCGGGCGGCGGGCGGCAGG + Exonic
1169276323 20:4235833-4235855 GGGGCTGGGGGGTGCACGGCAGG + Intronic
1170578503 20:17681625-17681647 GGGGCGGGGCGGCGCACAGCTGG - Intronic
1171107975 20:22453863-22453885 GACGCCAGGCGGGGAGCGGCCGG + Intergenic
1172520589 20:35563022-35563044 GGGGCGGGGCGGGGGAGGGCGGG - Intergenic
1172539429 20:35699460-35699482 GGCGCCGGGCGACGCGGGGCCGG + Intronic
1172765082 20:37346643-37346665 GGGGCCGGGGGGCGCAGGGCCGG - Intronic
1172765715 20:37349710-37349732 GGTGCCGGTTGGGGCAGGGCTGG + Intronic
1172848418 20:37944170-37944192 GGCGGCGGGGCGGGCGCGGCGGG - Exonic
1172890543 20:38260792-38260814 GGGGCGGGGCGGGGCGCGGCGGG + Intronic
1173930228 20:46811613-46811635 GGCGCCGGGGGGCGGACAGCAGG + Intergenic
1175267079 20:57709595-57709617 GGCGCGGCGCGGGGCGCGGGGGG + Exonic
1175284537 20:57829111-57829133 GGGGCAGGGCAGGGCAGGGCAGG + Intergenic
1175358565 20:58389337-58389359 GGGACCGGTCGGGGCACGGGCGG - Exonic
1175399586 20:58692859-58692881 CGGGCCGGGCCGGGCAGGGCCGG + Exonic
1175756435 20:61533264-61533286 GGGGCAGGCCTGGGCACGGCAGG + Intronic
1175847401 20:62065899-62065921 GGCGGGGGGCGGCGCGCGGCCGG + Intergenic
1175873837 20:62220358-62220380 GGCGCCGGGCGGGGCGGGGGCGG - Intergenic
1175926542 20:62474232-62474254 GGCGCCGGGCCGGGCCTGGAGGG - Intronic
1176022742 20:62970477-62970499 GGCGCAGGCCCAGGCACGGCAGG + Intergenic
1176135641 20:63520943-63520965 GGCGAGGGGCGGGGCTGGGCCGG + Intronic
1176148086 20:63574283-63574305 GGGGCAGGGCGGGGCGGGGCGGG - Intergenic
1176171527 20:63698458-63698480 GGCGCAGGACGGGGCGCTGCTGG + Exonic
1176177702 20:63736527-63736549 GGCTTCGGGCGGGGCGCAGCAGG + Intronic
1176178658 20:63739836-63739858 GGCCCCGGGCCGGGCCGGGCTGG - Intronic
1176187789 20:63790847-63790869 GACGCCGGGCGGGGCGCAGGAGG + Exonic
1176194394 20:63830825-63830847 GGCGCGGGGCGGGGCGCGCGGGG - Intronic
1176207234 20:63895539-63895561 GGAGCCGGGCCGGGCCGGGCCGG + Intronic
1176223088 20:63979289-63979311 GGGGCGGGGCGGGACCCGGCGGG - Intronic
1176242133 20:64080041-64080063 AGCGCGGGGCGGGGCGCGGCGGG - Intergenic
1176243006 20:64083745-64083767 GGAGCCGGCCGGGGCGGGGCGGG - Intronic
1176547348 21:8207650-8207672 GACGCCGGGCCCGGCCCGGCGGG - Intergenic
1176555253 21:8251859-8251881 GACGCCGGGCCCGGCCCGGCGGG - Intergenic
1176566299 21:8390697-8390719 GACGCCGGGCCCGGCCCGGCGGG - Intergenic
1177010915 21:15729878-15729900 GCCGGCGGGCGGGGCTCTGCGGG + Intergenic
1178334640 21:31732193-31732215 GGCGCAGGGCGGGACGAGGCGGG - Intergenic
1178334643 21:31732203-31732225 GGTGCAGGGCGGCGCAGGGCGGG - Intergenic
1178695775 21:34792112-34792134 GGCGCCAGGCCTGGCCCGGCTGG - Exonic
1178948433 21:36966743-36966765 GGCGCGGGGGTGGGGACGGCGGG + Intronic
1179428746 21:41304226-41304248 GGCGCCTGGCTGGGCTCGGCGGG + Intronic
1179522468 21:41954020-41954042 GCCGCGGGGCGGGGCGGGGCGGG + Intergenic
1179529728 21:42010423-42010445 GGCGCCGGGCGCCGGAGGGCGGG + Intergenic
1179626896 21:42653935-42653957 GGGGCCGGGCGCGGCGGGGCGGG + Intronic
1179675036 21:42975103-42975125 GGCGCGCGGCGGGGCGGGGCCGG + Intronic
1179921447 21:44509745-44509767 GGGGCAGGGCTGGGCACAGCTGG - Intronic
1180011677 21:45055305-45055327 GGCGCCGGGGAGTGCACGGAAGG + Intergenic
1180053929 21:45347357-45347379 AGCGCCAGCCGGGGCACGACAGG + Intergenic
1180064288 21:45405044-45405066 GGCGCGGGGCGGGGCCGGGCAGG - Intergenic
1180182875 21:46125651-46125673 GGGGCCGGGCGGGGCGTGGGAGG + Intronic
1180559191 22:16601853-16601875 GGGGCCGGGCGGGGAGCGGGCGG - Intergenic
1180615122 22:17121371-17121393 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1180797147 22:18611507-18611529 GGCGCCGGAAGGGGCGCGCCGGG - Exonic
1180837310 22:18936336-18936358 GGGGCGGGGCGGGGCGGGGCGGG - Exonic
1180837313 22:18936341-18936363 GGGGCGGGGCGGGGCGGGGCGGG - Exonic
1180837316 22:18936346-18936368 GGGGCGGGGCGGGGCGGGGCGGG - Exonic
1180908367 22:19431579-19431601 GGCGCGGGGCGGGCGGCGGCCGG - Exonic
1180914845 22:19479006-19479028 AGGGCCCGGCGGGGCAGGGCGGG - Intronic
1180960584 22:19760686-19760708 GGCCCCGGGCGGGGCGGGGCGGG + Intronic
1180991823 22:19941700-19941722 GGCGCGGCGCGGGGCGCAGCAGG - Exonic
1181045410 22:20211898-20211920 GGGGCCGAGCAGGGCAGGGCTGG - Intergenic
1181068815 22:20320138-20320160 GGCGCGGGGCAGGGCGGGGCAGG - Intergenic
1181068817 22:20320143-20320165 GGCGGGGCGCGGGGCAGGGCGGG - Intergenic
1181085539 22:20437828-20437850 GAGGCCGGGCGGGGGGCGGCAGG + Exonic
1181224576 22:21383764-21383786 GGCGCCGGAAGGGGCGCGCCGGG + Exonic
1181254056 22:21551049-21551071 GGCGCCGGAAGGGGCGCGCCGGG - Exonic
1181457960 22:23070354-23070376 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
1181478068 22:23180758-23180780 CGCGCGGGGCGGGGCGCGCCGGG - Exonic
1181671697 22:24428251-24428273 GGAGCTCGGCAGGGCACGGCAGG - Intronic
1181831613 22:25564798-25564820 GGCGCCGGGCGGCGCGCGAGGGG + Intergenic
1182282519 22:29225643-29225665 GGCCTGGGGCGGGGCAGGGCAGG - Intronic
1182295278 22:29308534-29308556 GGCGCGGCGTGGGGCACGCCTGG + Exonic
1182354101 22:29714481-29714503 GGGGCAGGGCAGGGCAGGGCAGG + Intergenic
1182772130 22:32803368-32803390 AGGGCCGGGAGGGGCACTGCTGG + Intronic
1183080475 22:35452574-35452596 GGCAGCGGGCAGGGCAGGGCAGG + Intergenic
1183093959 22:35541210-35541232 GGCTCGGGGCAGGGCAGGGCCGG + Exonic
1183093998 22:35541322-35541344 GACGCCGGGCTGGGCGCGGCCGG - Exonic
1183387990 22:37526070-37526092 GGTGAGGGGCGGGGCAAGGCAGG - Intergenic
1183407879 22:37639435-37639457 GGGGCTGGGCGGGGCGCTGCGGG + Intronic
1183528121 22:38336268-38336290 GGGGCGGGGCGGGGCGGGGCCGG - Intronic
1183528123 22:38336273-38336295 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1183720179 22:39557887-39557909 GGCGGCGGGCGGGGGGCGGCGGG - Intergenic
1183893700 22:40951152-40951174 GGGGCCGGGCGGGGCCGGGCGGG - Intergenic
1183903187 22:41021681-41021703 GAGGCCGGGCGGGGCGGGGCAGG - Intergenic
1184073436 22:42161264-42161286 GGGGCGGGGCGGGGCAGGGCAGG + Exonic
1184164787 22:42720810-42720832 GGCGGCGGGCGGCGGACAGCGGG + Intronic
1184276553 22:43412167-43412189 GGAGGCGGGCGGGGCGCGGCGGG + Intronic
1184473979 22:44710876-44710898 GCCGCAGGGCAGGGCAGGGCAGG + Intronic
1184510020 22:44927954-44927976 GGGGCGGGGCGGGGCACAGCTGG + Intronic
1184690109 22:46113635-46113657 GGTGCTGGGCGGGGGGCGGCGGG + Intronic
1184759759 22:46537656-46537678 GGGGCGGGGCGGGGCCGGGCCGG - Intergenic
1184796954 22:46738233-46738255 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
1185037922 22:48489434-48489456 GGCGCGGCGCGGGGCGCGGTGGG + Intergenic
1185258538 22:49849374-49849396 GGCGCGGGGCGGGACAGGGTGGG + Intergenic
1185259504 22:49853800-49853822 GGCGCGGGGCGGGGCTGGCCGGG - Intergenic
1185272392 22:49935334-49935356 GGCGCGGGGTGGGGCGCGGGGGG + Intergenic
1185313938 22:50170704-50170726 GGCGGGGGGCGCGGCCCGGCGGG - Intergenic
1185335763 22:50270312-50270334 GGCGCGGGGCTGGGCCCGGGCGG - Exonic
1185343201 22:50300544-50300566 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1185366018 22:50437094-50437116 GGTGCCGGGAAGGGCCCGGCAGG - Intronic
1203252221 22_KI270733v1_random:123935-123957 GACGCCGGGCCCGGCCCGGCGGG - Intergenic
1203287403 22_KI270734v1_random:161635-161657 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1203287406 22_KI270734v1_random:161640-161662 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1203287409 22_KI270734v1_random:161645-161667 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
950153737 3:10707684-10707706 GGCGGCGGGCGGGGCGGGCCGGG - Intronic
950400948 3:12768888-12768910 GGGGCGGGGCGGGGCAGGGCGGG + Intronic
950518066 3:13480279-13480301 GGGGCGGGGCGGGGCGCGGGTGG - Exonic
950902920 3:16513416-16513438 GGCGGCGGGGGGGGCGCGACAGG - Intronic
952889167 3:38029553-38029575 CGCGGCGGGAGGGGCACCGCGGG + Intronic
953246685 3:41199755-41199777 GGCGGCGGGCTGGGCGCAGCCGG + Intronic
953326069 3:42013560-42013582 GGCGGCGGGCGGGGCTGGGAAGG + Intergenic
953413184 3:42701576-42701598 GGGGCCAGGCGGGGCCAGGCGGG + Intronic
953447373 3:42979616-42979638 GGAGCCGGCCGGGGCACCGCCGG + Exonic
953618223 3:44510727-44510749 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
953618226 3:44510734-44510756 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
953618229 3:44510741-44510763 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
953618232 3:44510748-44510770 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
953618235 3:44510755-44510777 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
953705170 3:45225613-45225635 GGCGGCGGGCGGCGCGCAGCAGG - Exonic
953924730 3:46976885-46976907 GGGGCGGGGCGGGGCAAGGCGGG - Intronic
953979510 3:47406626-47406648 GCCCCAGGGCGGGGCAGGGCGGG + Intronic
954028694 3:47803055-47803077 GACGCCGGGTGGGGAACGCCGGG + Exonic
954106029 3:48410242-48410264 GACTCCGGGCTGGGCACAGCAGG + Intronic
954149062 3:48648230-48648252 GGGGTAGGGCGGGGCACAGCAGG - Intronic
954249631 3:49358003-49358025 TGCGCCGGGCGGAGCGGGGCGGG - Intronic
954277853 3:49554303-49554325 GGAGCCGGGCGGGGGCCGGCGGG - Intergenic
954387753 3:50253198-50253220 GGGGCTGGGCAGGGCAGGGCAGG + Intronic
954615532 3:51967295-51967317 CGGGCCGGGCGGGGCACGGCGGG - Intronic
954717462 3:52533739-52533761 GGCGGCGGGCGGCGCGCGGTGGG - Exonic
954717475 3:52533780-52533802 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
954794928 3:53156628-53156650 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
954797551 3:53169179-53169201 AGCGCTGGGAGGGGAACGGCGGG + Intronic
954812375 3:53256050-53256072 GTCGCCGGGCGGGGCGGGGCGGG + Intronic
955161483 3:56468463-56468485 GGCGCGGGGCCGGGCGGGGCCGG + Intergenic
956675072 3:71725440-71725462 CGCGCGGGGCGGGGCGGGGCGGG - Intronic
956675095 3:71725487-71725509 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
956675098 3:71725494-71725516 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
956675122 3:71725541-71725563 GGGGCCGTGGGAGGCACGGCCGG + Intronic
958942920 3:100334858-100334880 GGCGCCGGCGGTGGCTCGGCCGG + Intronic
959078935 3:101779611-101779633 GGGGCGGGGCGGGGCGGGGCCGG + Intronic
959398366 3:105869043-105869065 GGCTCGGGGCGGGGCGGGGCGGG + Exonic
960101257 3:113745909-113745931 GCAGCCGGGCAGGGCCCGGCCGG - Intronic
960625353 3:119677004-119677026 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
960664252 3:120094533-120094555 GGCGCTGGGCGGTGTAAGGCTGG - Intergenic
960937662 3:122913322-122913344 GACGCAGGGCGGGGCACGGCAGG - Exonic
961067056 3:123884361-123884383 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
961305844 3:125958862-125958884 GGCGCTGGGCGGGGCTCTTCTGG - Intergenic
961599883 3:128052388-128052410 GGCGCGGCGCGGGGCGGGGCCGG - Exonic
961612570 3:128152901-128152923 GGCGGGGGGCGGGGGAGGGCGGG - Intronic
961666513 3:128496414-128496436 GGCGCCGGGCGAGGATGGGCTGG + Intergenic
961688241 3:128650405-128650427 GGCGGCGGGCGGGGCACAGGGGG - Intronic
961743072 3:129046172-129046194 TGGGCCGGGAGGCGCACGGCCGG - Intergenic
961762821 3:129184052-129184074 GGCCGCGCGCGGGGCACGGCGGG - Intergenic
963091404 3:141486937-141486959 CGCGGCGGGCGGGGCGGGGCGGG + Intergenic
964720411 3:159763941-159763963 GGGGCGGGGCGGGGCGGGGCCGG + Intronic
964720413 3:159763946-159763968 GGGGCGGGGCGGGGCCGGGCCGG + Intronic
964720417 3:159763956-159763978 GGGGCCGGGCCGGGCCGGGCCGG + Intronic
965558137 3:170038078-170038100 CGCGCGGGGCGGGGCGGGGCGGG + Exonic
965558140 3:170038083-170038105 GGGGCGGGGCGGGGCGGGGCGGG + Exonic
966182124 3:177197285-177197307 GGCGCCGGGCGGGCGGGGGCGGG + Intronic
966696259 3:182793445-182793467 GGGGCCGGGCGGGGCGGGGCGGG + Intergenic
966794054 3:183697719-183697741 GGGGCGGGGCGGGGCGGGGCTGG - Intergenic
966886424 3:184380117-184380139 GGCGCCGGGCCGGGCGGGGCGGG - Exonic
967858244 3:194134247-194134269 GGCGCCGGGCCGGGAGCGCCAGG - Intergenic
968063955 3:195747970-195747992 GGGGCGGGGCGGGGCCGGGCTGG - Intronic
968066640 3:195762750-195762772 GGCGCGTGGCGGTGCAGGGCCGG - Intronic
968506534 4:973601-973623 GGGGCGGGGCGGGGCGCTGCTGG + Intronic
968514220 4:1009657-1009679 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
968514223 4:1009662-1009684 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
968674549 4:1870810-1870832 GGCTCCGGGCCCGCCACGGCGGG + Intergenic
968701891 4:2061328-2061350 GGGGCTGGGGGAGGCACGGCCGG + Intronic
968815133 4:2818129-2818151 GGGGCCGGGAGGGGCGCGCCGGG + Intronic
968879890 4:3293301-3293323 GGCGCGGGGCGGGGCGGGGCGGG + Intronic
968883103 4:3311246-3311268 GGCCCCGAGCGAGGCAGGGCTGG - Intronic
968981528 4:3852573-3852595 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
968981531 4:3852578-3852600 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
968981534 4:3852583-3852605 GGTGCGGGGCGGGGCGGGGCGGG - Intergenic
969153197 4:5187609-5187631 GGGGCCGGGCGGGGGAGGGGGGG + Intronic
969239332 4:5888650-5888672 TGCGCAGGGCGGGGGTCGGCGGG - Intronic
969379415 4:6783679-6783701 GGCGCGGGGCGCGGCGCGGGGGG + Intronic
969716797 4:8871762-8871784 CGCGCCGGGCTGGGCTGGGCCGG + Exonic
970421074 4:15906106-15906128 GGCGGCGGGCGGGCCCGGGCGGG + Intergenic
970456209 4:16226522-16226544 GGCGAGGGGCGGGGCGAGGCGGG - Exonic
971244088 4:24912942-24912964 GGGGCCGCGCGGGGCCCGGGCGG - Intronic
971279824 4:25233978-25234000 GGCGCGAGGTGGGGCGCGGCCGG + Exonic
971351871 4:25862807-25862829 GGCGCGGCGCGGGGCTCGGGTGG - Exonic
971457960 4:26861384-26861406 GGCGGCGGGCGGGGCTCGGCCGG + Intronic
972632876 4:40857185-40857207 CGCGGCGGGCGGGGCAGGGAGGG - Intronic
973317696 4:48779533-48779555 GGCGGCTGGCGGGCCCCGGCGGG - Intronic
973758964 4:54100153-54100175 GGCGCCGGGCGGGGGACGTGAGG + Exonic
973774108 4:54230003-54230025 GGAGGCGGGCTGGGCTCGGCTGG + Intronic
975139167 4:70902606-70902628 GGCGACGGGCGGCGGGCGGCGGG - Intronic
977536546 4:98261351-98261373 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
977536549 4:98261356-98261378 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
977536552 4:98261361-98261383 GGCGGGGGGCGGGGCGGGGCGGG - Intergenic
978954581 4:114598683-114598705 CACGCAGGGCGGGGCGCGGCTGG + Exonic
979349615 4:119628832-119628854 CGCGCGGGGCGGGGCGGGGCAGG - Exonic
979547230 4:121951789-121951811 GGCCCCGGGCGGCCCAGGGCGGG + Intergenic
982257641 4:153466267-153466289 GGCGCGGGGCGGGGCGGGGCGGG + Intergenic
982257644 4:153466272-153466294 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
982257647 4:153466277-153466299 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
982257650 4:153466282-153466304 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
983090224 4:163494171-163494193 GGGGCGGGGCGGGGCAGGGCAGG + Intergenic
983090226 4:163494176-163494198 GGGGCGGGGCAGGGCAGGGCAGG + Intergenic
983090228 4:163494181-163494203 GGGGCAGGGCAGGGCAGGGCAGG + Intergenic
984140836 4:176002162-176002184 GGCGGGGGGCGGGGGACGCCAGG + Intronic
984638856 4:182142693-182142715 GGCGACGGCCGGGGCAGGCCTGG + Intergenic
985064064 4:186104745-186104767 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
985113808 4:186571971-186571993 GGGGCGGGGCGGGGCAGGGCGGG + Intergenic
985629984 5:1009164-1009186 GGCGGCGGCTGCGGCACGGCGGG - Exonic
985636067 5:1036479-1036501 GGGGGGGGGCGGGGCAGGGCAGG - Intronic
985708369 5:1414440-1414462 GGGGCCGGGAGGGGCAGGGCGGG + Intronic
985805276 5:2038881-2038903 GGGGCCGGGCAGGGCTGGGCTGG + Intergenic
985995897 5:3596560-3596582 GAGGCCGGGCGGGTGACGGCTGG + Intronic
986402771 5:7395999-7396021 CGCGCGGGGCGGGGAGCGGCGGG + Intergenic
987099841 5:14581967-14581989 GGGGCCGGGCGGGGCGGGGCGGG + Intronic
988369277 5:30346008-30346030 GGGGCCGGGGGGGGCGCGGGGGG - Intergenic
988577774 5:32444041-32444063 CGGGCCGGGCCGGGCAAGGCGGG + Intronic
988577788 5:32444061-32444083 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
990165475 5:52989227-52989249 GGGGTGGGGCGGGGCGCGGCCGG + Intergenic
990509969 5:56481149-56481171 GGGGCCGTGGGGGGCGCGGCGGG - Intronic
992473192 5:77077526-77077548 GGCGGCGGGCAGGGCGCGGCAGG + Exonic
992769633 5:80035292-80035314 GCGGCCGGGCGGGGGAGGGCCGG - Intronic
995735681 5:115296890-115296912 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
996937478 5:128965444-128965466 GGGGCTGGGCGGGGCAGGACGGG + Exonic
997454427 5:134006311-134006333 GAGGCCGGGCGGGACAAGGCGGG + Intergenic
997704017 5:135930286-135930308 GGCGCGAGGCGGGGCCAGGCGGG + Intronic
998018955 5:138753723-138753745 GGGGCCCGGGCGGGCACGGCCGG + Intronic
998101534 5:139439153-139439175 GGCCCTGGGCGGGGCACGGGCGG + Intronic
998303616 5:141051647-141051669 GGCTGCGCGCGGGGCGCGGCTGG + Exonic
998331839 5:141334480-141334502 GGGGCGGGGCGGGGCGGGGCAGG + Intronic
998936534 5:147235039-147235061 AGCGCCGGGCTGGGCTGGGCTGG - Exonic
999695939 5:154189253-154189275 AGGGCAGGGCAGGGCACGGCAGG + Intronic
1001064991 5:168529366-168529388 GGCGGCGGGCGGCGGGCGGCGGG - Exonic
1001512982 5:172336696-172336718 GGGGAGGGGCGGGGCAGGGCAGG + Exonic
1001512984 5:172336701-172336723 GGGGCGGGGCAGGGCAGGGCAGG + Exonic
1001549853 5:172594981-172595003 GCCCCCGGGCTGGGCACTGCGGG + Intergenic
1001577054 5:172771321-172771343 GGCGCCTGGCCTGGCAGGGCGGG - Intergenic
1002057983 5:176609775-176609797 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1002057986 5:176609780-176609802 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1002170318 5:177371044-177371066 GCCGCGGGGCGGGGCGGGGCGGG + Intronic
1002170321 5:177371049-177371071 GGGGCGGGGCGGGGCGGGGCCGG + Intronic
1002170323 5:177371054-177371076 GGGGCGGGGCGGGGCCGGGCCGG + Intronic
1002190017 5:177473241-177473263 CGGGCCAGGCGGGGCACTGCCGG - Intronic
1002497060 5:179622944-179622966 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1002541293 5:179907924-179907946 GGGGCGGGGCGGGGCCGGGCGGG + Intergenic
1002645271 5:180649625-180649647 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1002662789 5:180802899-180802921 GCCGGGGGGCGGGGCGCGGCGGG - Intronic
1003097980 6:3157266-3157288 GCCGCCGGGCGGGGTCCGGGAGG - Intronic
1003098709 6:3160754-3160776 GGCGGGGGGCGGGGAAGGGCAGG + Intergenic
1003099049 6:3163165-3163187 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1003099052 6:3163170-3163192 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1003139350 6:3457324-3457346 CGCGCCGGGCGGGGCGGGGGAGG + Intergenic
1004167998 6:13273907-13273929 GGCACGGGGCGGGGCGGGGCGGG - Intronic
1004503165 6:16227009-16227031 GGGGCGGGGCGGGGCTGGGCTGG - Intergenic
1004503167 6:16227014-16227036 GGGGCGGGGCGGGGCGGGGCTGG - Intergenic
1004615189 6:17281967-17281989 GGGGCCGGGCAGGGCAGAGCAGG + Intronic
1005512145 6:26520900-26520922 GGCGGCGGGCGAGGGAGGGCGGG - Intergenic
1005915237 6:30345418-30345440 GGCGGCGGGCGGGACGCGGGAGG + Intronic
1006114953 6:31770601-31770623 AGTGCAGGGCGGGGCAGGGCGGG + Intronic
1006114957 6:31770611-31770633 GGGGCAGGGCGGGGCAGGGCAGG + Intronic
1006369223 6:33633833-33633855 GGCGCGGGGCGGGGCCGGGCCGG + Intronic
1006472335 6:34236000-34236022 GGCGCCGGGCGGGCCAGGCGTGG + Intergenic
1006475368 6:34249262-34249284 GGGGCCGGACGGGGTAGGGCGGG + Exonic
1006752574 6:36387831-36387853 GGAGCAGGGCAGGGCAGGGCAGG + Intergenic
1006832323 6:36976422-36976444 GGGGCCGGGCCTGGCAGGGCTGG - Intronic
1007111136 6:39314048-39314070 GGCGTCGGCCTGGGCGCGGCGGG - Intronic
1007431510 6:41779898-41779920 GCCGCGGGGCGGGGCGGGGCGGG - Exonic
1007465844 6:42050471-42050493 GTCGCGGGGCGGGGCGGGGCGGG - Intergenic
1007478313 6:42133825-42133847 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1007479029 6:42137818-42137840 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1007479032 6:42137823-42137845 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1007600119 6:43076230-43076252 GGCGCCGTGCGGGGGCCGGAGGG + Intergenic
1007937069 6:45741896-45741918 GGCGCGGGGCGGGGCTGGGGTGG - Intergenic
1007967645 6:46016412-46016434 GGGGACGGGCAGGGCAGGGCAGG + Intronic
1008545020 6:52576733-52576755 TGTGCCGGGCGGTGCACGACAGG + Intronic
1008945283 6:57090159-57090181 AGCGCCAGGCGGTGCAGGGCGGG + Exonic
1010703364 6:79077962-79077984 GGCGGGGGGCGGGGGACCGCGGG + Intronic
1012895499 6:104941446-104941468 AGGGCGGGGCGGGGCAGGGCGGG + Intergenic
1013372598 6:109483367-109483389 GGGGCGGGGCGGGGCAAGGCGGG + Intergenic
1013372601 6:109483377-109483399 GGGGCAAGGCGGGGCAAGGCAGG + Intergenic
1013372647 6:109483497-109483519 GCGGCGGGGCGGGGCAGGGCGGG + Intergenic
1013459054 6:110358116-110358138 GCCGCCAGGCCGGGCCCGGCGGG + Exonic
1013792671 6:113855098-113855120 GGGTGCGGGCGGGGCGCGGCGGG - Intergenic
1014045229 6:116877189-116877211 GGGGCGGGGCGGGGCGGGGCTGG - Intergenic
1014098180 6:117482582-117482604 GGGGCGGGGCGGGGCCGGGCGGG + Intronic
1015328547 6:131951206-131951228 GGCGGCGAGCGGGGAGCGGCGGG + Exonic
1016340910 6:143060801-143060823 GGCGCGGGGCGGGGCGGGGCGGG - Intronic
1017010053 6:150057560-150057582 GGCCCCGGGCGGGTCACCGCGGG + Intergenic
1017671983 6:156777762-156777784 GGCGCCGGCCGCGGCCCGGGGGG - Intergenic
1017738222 6:157381942-157381964 GGCGGCGGTCGTGGCTCGGCGGG + Exonic
1018013602 6:159693337-159693359 GGCGCGGGGCGGGGCCCGCGGGG - Intronic
1018091097 6:160347816-160347838 GGGGCAGGGCAGGGCAGGGCAGG - Intergenic
1018400301 6:163414544-163414566 GGCGGCGGGCGGGGCCGCGCAGG - Intronic
1018686647 6:166308493-166308515 GGCCCCGGGCTGTGCCCGGCTGG + Intergenic
1018729164 6:166636118-166636140 GGAGCAGGGTGGGGCAGGGCGGG - Intronic
1018876523 6:167826859-167826881 GGCGGCGGGCGGGGCGCGGGCGG + Intergenic
1018947563 6:168357604-168357626 GGCGCAGGACGGTGCCCGGCAGG + Intergenic
1018947753 6:168358208-168358230 GGCGCAGGACGGTGCCCGGCAGG + Intergenic
1018947958 6:168358867-168358889 GGCGCAGGACGGTGCCCGGCAGG + Intergenic
1019112155 6:169724666-169724688 GGGGCGGGGAGGGGCGCGGCGGG - Intronic
1019474296 7:1236618-1236640 GGCGGCGCGGGCGGCACGGCGGG - Exonic
1019504728 7:1385246-1385268 GGGGCAGGCCGGGGCAGGGCAGG + Intergenic
1019560656 7:1654945-1654967 TGCGCTGGGCGGGGCGAGGCTGG - Intergenic
1019563979 7:1670688-1670710 GGCGCCGGGCAGGGTGCGGACGG - Intergenic
1019656634 7:2199614-2199636 CGTGCCAGGCGGGGCACTGCGGG - Intronic
1021231113 7:18086964-18086986 AGCGGCGGGCGCGGCGCGGCCGG - Intronic
1021452791 7:20798117-20798139 GGGGCGGGGCGGGGCTGGGCCGG - Intergenic
1022089290 7:27097033-27097055 GGGGCCGGGCGGTGCGCTGCAGG + Intergenic
1022923233 7:35037119-35037141 TGCGGCGCGCGGGGCGCGGCCGG - Intronic
1023791861 7:43758890-43758912 GGGCCCGGGCGGGGCGGGGCGGG - Intronic
1023820037 7:43975491-43975513 GGCGGCTGGCGGGGGACTGCTGG - Intergenic
1023850279 7:44146293-44146315 GGCCCGGGGCGGGGCACAGGGGG - Intronic
1025004432 7:55343562-55343584 GCCGGTGGGCGGGGCACCGCGGG - Intergenic
1025069766 7:55887805-55887827 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1025069769 7:55887812-55887834 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1025069772 7:55887819-55887841 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1025609843 7:63068370-63068392 GGGGCGGGGCGGGGCGCGCCTGG - Intergenic
1026909496 7:74083962-74083984 GACGGGGGGCGGGGCCCGGCGGG - Exonic
1027248021 7:76380202-76380224 GGAGCCGCGCGGGGCGGGGCTGG - Intergenic
1028345747 7:89779958-89779980 GGGGCAGGGCAGGGCAGGGCAGG - Intergenic
1028417469 7:90595953-90595975 GCGGCCGGGAGGGGCGCGGCCGG + Intronic
1029123165 7:98281657-98281679 GACGCGGGGCGGGGCGGGGCGGG - Exonic
1029123244 7:98281895-98281917 GGCGGCGGCGGGGGCGCGGCGGG - Exonic
1029238738 7:99143826-99143848 GGGGCCGGGCCGGGCCGGGCTGG - Exonic
1029421204 7:100472697-100472719 GGGGCTGGGCGGGGCTGGGCAGG - Intronic
1029748316 7:102528944-102528966 GGCGGCTGGCGGGGGACTGCTGG - Intergenic
1029766263 7:102628031-102628053 GGCGGCTGGCGGGGGACTGCTGG - Intronic
1030941685 7:115658692-115658714 GACTCCGGGTGGGGCAGGGCTGG - Intergenic
1031656385 7:124361072-124361094 AGGGCAGGGCGGGGCAGGGCAGG - Intergenic
1031886260 7:127249220-127249242 AGCGCAGGGCAGGGCAGGGCAGG - Intronic
1032011901 7:128352368-128352390 GGCGCCGGGCGGGCACCGCCAGG + Exonic
1032525798 7:132577433-132577455 GGCGGCGGGCGGCGGGCGGCAGG - Intronic
1033134589 7:138773973-138773995 GGAGCCGGGAGGGGCGCTGCGGG - Intronic
1033220386 7:139523622-139523644 GGACCCGGGCGGGGCGGGGCAGG - Intergenic
1033314720 7:140287844-140287866 GGGGCAGGGCAGGGCAGGGCAGG + Intergenic
1034188346 7:149195886-149195908 CGAGGCGGGCGGGGCACGGCCGG + Intronic
1034228037 7:149497867-149497889 GGGGCTGGGCGGGGCGGGGCGGG - Intergenic
1034448743 7:151126371-151126393 GGAGCGGGGCGGGGCGGGGCCGG + Intronic
1034618065 7:152436014-152436036 GGGGCCGGGCGGGGGGCGGCGGG + Intergenic
1034898459 7:154892566-154892588 GGGGCGGGGCGGGGCGGGGCCGG + Exonic
1035129714 7:156640664-156640686 GGGGCGGGGCGGGGCAGGGCTGG + Intronic
1035553084 8:544865-544887 TGGGCCGGGCGGGGCTAGGCGGG + Intronic
1035717066 8:1763386-1763408 GGGGCGGGGCGCGGCGCGGCGGG - Intronic
1035717076 8:1763408-1763430 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717085 8:1763425-1763447 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717094 8:1763442-1763464 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717103 8:1763459-1763481 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717112 8:1763476-1763498 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717121 8:1763493-1763515 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717130 8:1763510-1763532 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717139 8:1763527-1763549 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717148 8:1763544-1763566 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717157 8:1763561-1763583 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717166 8:1763578-1763600 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717175 8:1763595-1763617 CGCGGGGGGCGGGGCGCGGCGGG - Intronic
1036398393 8:8387020-8387042 GGCGCCGGAGGGAGCAGGGCTGG + Intergenic
1036640324 8:10579588-10579610 GGGGCCGGGTGGGGGAAGGCTGG - Intergenic
1036708041 8:11059627-11059649 GGCGCGGGGCGGGGCGGGACAGG + Intronic
1036739431 8:11347596-11347618 TGCGCCGGGCGGGGCGGGGCGGG + Intergenic
1037589962 8:20303979-20304001 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1037589965 8:20303984-20304006 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1037589968 8:20303989-20304011 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1037589970 8:20303994-20304016 GGGGCGGGGCGGGGCGGGGCCGG + Intergenic
1037778242 8:21849594-21849616 AGCTCCGGGAGGGGCAGGGCAGG + Intergenic
1037815382 8:22109201-22109223 GGCGCCGGCCGGGGAGCCGCCGG - Exonic
1038041452 8:23727139-23727161 GGCCCCGGGCGGGTCAGGGGCGG + Intergenic
1038304114 8:26383521-26383543 GGAGCCGGGCGGGGCGGGGCGGG + Intronic
1038761210 8:30385056-30385078 CTCGCCGGGCCGGGCAGGGCTGG - Exonic
1038808059 8:30812644-30812666 GCGGCCGGGCGGGGAAGGGCGGG - Exonic
1039476442 8:37841610-37841632 GGCCCGGGGCGGGGCATGGGGGG - Exonic
1039484401 8:37899617-37899639 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1040065347 8:43140444-43140466 AGCGCAGGGCGGGGCGCAGCGGG + Exonic
1041266891 8:56074344-56074366 GGCGGCGGGCGGCGCAACGCAGG - Intronic
1041673608 8:60516826-60516848 GGCGCGGGGCGGGGCGGGGCGGG + Intergenic
1041673717 8:60517259-60517281 GGCCCCGGGCGCGGCCGGGCGGG + Intronic
1041714829 8:60923356-60923378 GGGGGGGGGCGGGGCGCGGCGGG + Intergenic
1042021395 8:64373767-64373789 GGTGGCGGGCGGGGGGCGGCGGG + Intergenic
1043372940 8:79613347-79613369 GGCGCGGCGCGGGGCTCTGCAGG - Intronic
1043527485 8:81112181-81112203 CGAGCCGGGCGGGGCCGGGCTGG + Intergenic
1044591519 8:93917513-93917535 GGGGCCGGGCCGGGCAGGGCGGG + Intronic
1044692894 8:94896255-94896277 GCGGCGGGGCGGGGCGCGGCAGG - Intronic
1044734806 8:95268756-95268778 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1044734809 8:95268761-95268783 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1044734812 8:95268766-95268788 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1044734815 8:95268771-95268793 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1045115334 8:98974267-98974289 GGCGCGGGGCTGGGCTCGGCCGG + Intergenic
1046871327 8:119208512-119208534 GGCGGCGGGAAGGACACGGCGGG - Exonic
1048472156 8:134713105-134713127 GGCGCCGAGCGCGGCCCGGCAGG + Intergenic
1048553920 8:135457401-135457423 GGAGCCGGGCGGGGCGGGGCCGG + Intergenic
1048980947 8:139703222-139703244 GGCGGCTGGCGGGGCAGGGGCGG + Intergenic
1049166284 8:141128275-141128297 GGCGGCCGGCGGGGCTGGGCGGG + Intronic
1049227678 8:141465559-141465581 GGTGCAGGGCAGTGCACGGCAGG + Intergenic
1049272124 8:141701421-141701443 GGCTCGGGGCTGGGCATGGCAGG - Intergenic
1049419490 8:142510603-142510625 GGCGCGGGGCGGGCGACTGCCGG + Intronic
1049419595 8:142510907-142510929 GGGGGCGGGCGGGACACGGGAGG - Intronic
1049473834 8:142787892-142787914 GGCCCAGGGCAGGGCAGGGCCGG + Intergenic
1049580338 8:143408022-143408044 GGGGCAGGGCGGGGACCGGCCGG - Intergenic
1049585365 8:143430423-143430445 GCCGCCCGTCGGGGCGCGGCCGG - Intergenic
1049586750 8:143435922-143435944 GAGCCCTGGCGGGGCACGGCCGG - Intergenic
1049620836 8:143597739-143597761 GGCGCGGGGCGGGGCCGGGCCGG + Intronic
1049673173 8:143878546-143878568 GACGCGGGGCGGGGCGGGGCGGG + Intergenic
1049752361 8:144291363-144291385 GGCGCGCGGTGGGGCATGGCGGG - Exonic
1049765777 8:144354576-144354598 GGGGCGGGGCGGGGCGGGGCTGG - Intronic
1049879436 8:145052231-145052253 CGGGCGGGGCGGGGCGCGGCTGG - Intergenic
1049883078 9:11155-11177 GGCGCCGGGCTGGGGGCGGGGGG + Intergenic
1049996826 9:1042701-1042723 GTCGCCGTGCGGGGCGCAGCGGG - Intergenic
1049998374 9:1051713-1051735 GGCGGCGGGCTGGGCCCGGGGGG - Exonic
1050230893 9:3525492-3525514 GGCGCAGGGCCGGGGCCGGCGGG + Intronic
1050472294 9:6007030-6007052 GGCGCTGGGCGGGGACCGGAGGG - Intronic
1051897787 9:22006298-22006320 GATGCCGGCCGGGGCAAGGCAGG + Intronic
1052840487 9:33288538-33288560 GGGGCTGGGCAGGGCAGGGCAGG + Intergenic
1052896240 9:33750615-33750637 GGAGCGGGGCGGGGCGCAGCGGG + Exonic
1052982273 9:34458170-34458192 GGCGGCGGGCAGGCCAAGGCCGG - Intronic
1053010319 9:34629089-34629111 GGACCCGAGCGGGGCAGGGCGGG + Intergenic
1053016541 9:34665389-34665411 AGAGCCGGGCGGGGCGGGGCGGG + Intronic
1053050454 9:34957730-34957752 GGAGCCCTGCGGGGGACGGCTGG + Intronic
1053138304 9:35665361-35665383 GGCGCCGGCCAAGGCAGGGCAGG + Intronic
1053230201 9:36401199-36401221 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1053306129 9:36986058-36986080 GGTGCCGGGCGGGGGTCGGACGG - Intronic
1053569361 9:39288234-39288256 GGGGCCGGGCGCGGCTTGGCGGG - Intronic
1053835320 9:42129276-42129298 GGGGCCGGGCGCGGCTTGGCGGG - Exonic
1054090990 9:60847218-60847240 GGGGCCGGGCGCGGCTTGGCGGG - Intergenic
1054112401 9:61122774-61122796 GGGGCCGGGCGCGGCTTGGCGGG - Intergenic
1054127784 9:61330776-61330798 GGGGCCGGGCGCGGCTTGGCGGG + Intergenic
1054595304 9:67059355-67059377 GGGGCCGGGCGCGGCTTGGCGGG + Intergenic
1054906800 9:70419769-70419791 GTCCCCGGGCGGGGCGTGGCGGG + Intergenic
1055321606 9:75088217-75088239 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1056143640 9:83707984-83708006 GGCGCCGCGCGGAGCACGCCGGG + Exonic
1056560667 9:87726553-87726575 GGCTCCAGGCGTGGCAGGGCCGG - Intronic
1057146860 9:92764464-92764486 GGCGCCGGGCGGGGGTCGCAGGG + Intronic
1057313505 9:93955408-93955430 GGCGCGGGGCGGGGCGGGGCGGG - Intergenic
1057781915 9:98056973-98056995 GGCGCCGGGAGGGGCGGGGCGGG + Intronic
1057793982 9:98142836-98142858 AGCGCAGGGCAGGGCAGGGCAGG - Intronic
1057995628 9:99820033-99820055 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1057995631 9:99820038-99820060 CGCGCGGGGCGGGGCGGGGCGGG - Intergenic
1058908114 9:109497970-109497992 GGCGCCGGGTGGGGCTCGGCCGG - Intronic
1058908527 9:109499840-109499862 CGGGCCGGGCGGGGCGCGGGCGG - Intergenic
1059061398 9:111038257-111038279 GGCGGAGGGCCGGGCTCGGCTGG - Intronic
1059305422 9:113349828-113349850 CGCGCCTGGCGGGACCCGGCAGG + Intronic
1060478179 9:124000297-124000319 GGTGCGGGGAGGGCCACGGCAGG + Intergenic
1060629445 9:125143119-125143141 GGGGCCGGGAGGGGCAAGGCGGG - Intronic
1060811645 9:126614009-126614031 GGTCCCGGGCGGGGCGCAGCGGG - Intergenic
1060855932 9:126915031-126915053 GGGGCGGGGCGGGGCGGGGCGGG + Intronic
1060996346 9:127876654-127876676 GGAGGGGGGCGGGGCAGGGCGGG - Intronic
1061038902 9:128128434-128128456 GGCGCCGGGCGGGGCCATCCCGG - Exonic
1061061128 9:128250913-128250935 GACCCCGGGCGGGGCGCGGTTGG - Exonic
1061165977 9:128922374-128922396 GGGGCCGGGAGGGTCATGGCGGG + Intronic
1061453421 9:130681222-130681244 GCCGCGGGGCGGGGCGGGGCGGG - Intronic
1061542110 9:131283055-131283077 GGCGGGGGGCGGGGGACCGCGGG - Intergenic
1061580143 9:131531280-131531302 GGAGGCGCGCGGGGCACGCCGGG + Intergenic
1061583986 9:131554768-131554790 GGCGGCGGGCGAGGCCGGGCCGG + Intergenic
1061666362 9:132162816-132162838 GGCGCCGGGAGGGGGTCGGGAGG + Intronic
1061849768 9:133407494-133407516 AGGGCCGGGCAGGGCAGGGCTGG + Intronic
1061859360 9:133460241-133460263 GGGGCGGGGCGGGGCAGGGCAGG - Intronic
1061975876 9:134067870-134067892 GGCGGCGGGCCGGGCTGGGCCGG - Intronic
1062022533 9:134326263-134326285 CGCTCCGGGCGGGGCTGGGCGGG + Intronic
1062026202 9:134341890-134341912 GGGGCCTGGCTGGGCAGGGCTGG + Intronic
1062162476 9:135087844-135087866 GGCGGCGGGCGGGCGGCGGCGGG + Exonic
1062349848 9:136133299-136133321 GGGGCGGGGCGGGGCAGGCCGGG - Intergenic
1062362064 9:136192991-136193013 GGCGGCGGGTGAGGCAGGGCCGG - Intergenic
1062364732 9:136203224-136203246 GCCGCGGGGCGGGGCGGGGCCGG + Intronic
1062435786 9:136546081-136546103 GGGGCCGGGCGGGGCGGGGCCGG - Intergenic
1062453829 9:136626618-136626640 GGGGCAGGGCGGGGCAGGGGTGG + Intergenic
1062548984 9:137077398-137077420 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1062548987 9:137077403-137077425 GGGGCGGGGCGGGGCGGGGCGGG + Intergenic
1062600287 9:137316198-137316220 GGCGGAGGGCGGGGCGCGCCTGG + Intronic
1062609717 9:137368517-137368539 GGCTGCGATCGGGGCACGGCCGG + Intronic
1062653521 9:137590390-137590412 GGCTCCGGGCGGGACGAGGCTGG + Exonic
1062696402 9:137878232-137878254 GGGGCCGGGCGGGGCCGGGCGGG + Intronic
1185464220 X:345734-345756 GGCTGCGGGCGGGGCAGGGAAGG + Intronic
1186888451 X:13938076-13938098 GGGGCGGGGCGGGGCAGGACTGG + Intronic
1187281469 X:17860996-17861018 CGCGCCGGGCTGGGCGCGCCTGG - Intronic
1187670123 X:21658504-21658526 GGCACGGGGCGGGGCGCGCCCGG - Intergenic
1187768187 X:22666517-22666539 GGGGCGGGGCGGGGCGGGGCGGG - Intergenic
1188242686 X:27809545-27809567 GGCGGTGGGCGGGGCGGGGCGGG - Intronic
1189281067 X:39820624-39820646 GGAGGCGGCCGGGGCACCGCTGG - Intergenic
1189321566 X:40090454-40090476 GGGGCGGGGCGGGGCGGGGCTGG + Intronic
1190335174 X:49257720-49257742 GGCACCCTCCGGGGCACGGCTGG - Exonic
1190526334 X:51332768-51332790 GAAGCTGGGCGGGGCACGGGCGG - Intronic
1191829973 X:65406568-65406590 GGGGCTGGGCGGGGCTGGGCGGG + Intronic
1191829978 X:65406578-65406600 GGGGCTGGGCGGGGCTGGGCGGG + Intronic
1191829983 X:65406588-65406610 GGGGCTGGGCGGGGCTGGGCGGG + Intronic
1191829988 X:65406598-65406620 GGGGCTGGGCGGGGCTGGGCGGG + Intronic
1192212518 X:69136948-69136970 GGGGCGGGGCGGGGCCGGGCTGG - Intergenic
1193221816 X:78935183-78935205 GGCACTGGTCGGGGCAGGGCTGG + Intergenic
1194133718 X:90112590-90112612 GGAGCCGGGCGGGGGAGGACGGG - Intergenic
1195701687 X:107710560-107710582 GGGGCCGGGGGGGGGGCGGCAGG - Intergenic
1195728042 X:107937191-107937213 GGCGCGGGGCGGGGGACGGAGGG - Intergenic
1196684085 X:118495943-118495965 GGCGGCGGGCGGGTCTCGGCGGG - Exonic
1196816252 X:119667351-119667373 GGGGCCGGGCAGGGCAGGACAGG + Intronic
1197248181 X:124188050-124188072 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1197248184 X:124188055-124188077 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1197754305 X:129983708-129983730 GCCGCCGGGCCGGGCGCGGCGGG + Intronic
1198398991 X:136251454-136251476 GGGGCGGGGCGGGGCGGGGCGGG + Exonic
1198398994 X:136251459-136251481 GGGGCGGGGCGGGGCGGGGCGGG + Exonic
1199976608 X:152898142-152898164 GGCGCCCGGCCGGGCCGGGCCGG - Intergenic
1200084879 X:153599176-153599198 GGGGCGGGGCGGGGCGGGGCCGG - Exonic
1200084881 X:153599181-153599203 GGCGAGGGGCGGGGCGGGGCGGG - Exonic
1200102118 X:153693400-153693422 TGGGCAGGGCGGGGCAGGGCAGG - Intronic
1200102424 X:153694659-153694681 GGCGGGGGGCGAGGCAGGGCGGG + Intronic
1200117677 X:153776500-153776522 GGGGCAGGGCGAGGCAGGGCAGG + Intronic
1200117692 X:153776531-153776553 GGGGCGGGGCGAGGCAGGGCGGG + Intronic
1200117704 X:153776557-153776579 GGGGCGGGGCGAGGCAGGGCGGG + Intronic
1200117716 X:153776583-153776605 GGGGCGAGGCGGGGCAGGGCGGG + Intronic
1200117740 X:153776645-153776667 GGGGCGGGGCGAGGCACGGCAGG + Intronic
1200117753 X:153776676-153776698 GGGGCGGGGCGAGGCAGGGCGGG + Intronic
1200117774 X:153776720-153776742 GGGGCGGGGCGAGGCAAGGCAGG + Intronic
1200138534 X:153886263-153886285 GGGGCGGGGCGGGGCGGGGCGGG - Intronic
1200147614 X:153934783-153934805 GCCACCGGGCCGGGCTCGGCCGG + Intronic
1200229441 X:154436848-154436870 CGCGCGGGGCGGGGCGGGGCGGG + Intergenic
1200229445 X:154436858-154436880 GGGGCGGGGCGGGGCGCGGCGGG + Intergenic
1200240463 X:154490509-154490531 GGCGCCCGGCCGGGCCTGGCAGG - Exonic
1200402723 X:156028986-156029008 GGCGCCGGGCTGGGGGCGGGGGG - Intergenic