ID: 1126165900

View in Genome Browser
Species Human (GRCh38)
Location 15:45653585-45653607
Sequence CCCTCCCAAGGTTAGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126165888_1126165900 29 Left 1126165888 15:45653533-45653555 CCAACCCAGAAGCTCTTGTCTTG 0: 1
1: 0
2: 1
3: 9
4: 188
Right 1126165900 15:45653585-45653607 CCCTCCCAAGGTTAGAGGTGGGG 0: 1
1: 0
2: 0
3: 26
4: 240
1126165889_1126165900 25 Left 1126165889 15:45653537-45653559 CCCAGAAGCTCTTGTCTTGTTAT 0: 1
1: 0
2: 0
3: 12
4: 208
Right 1126165900 15:45653585-45653607 CCCTCCCAAGGTTAGAGGTGGGG 0: 1
1: 0
2: 0
3: 26
4: 240
1126165891_1126165900 -10 Left 1126165891 15:45653572-45653594 CCAGCCCCATTCTCCCTCCCAAG 0: 1
1: 0
2: 6
3: 122
4: 844
Right 1126165900 15:45653585-45653607 CCCTCCCAAGGTTAGAGGTGGGG 0: 1
1: 0
2: 0
3: 26
4: 240
1126165890_1126165900 24 Left 1126165890 15:45653538-45653560 CCAGAAGCTCTTGTCTTGTTATA 0: 1
1: 0
2: 0
3: 7
4: 186
Right 1126165900 15:45653585-45653607 CCCTCCCAAGGTTAGAGGTGGGG 0: 1
1: 0
2: 0
3: 26
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126165900 Original CRISPR CCCTCCCAAGGTTAGAGGTG GGG Intronic
900120322 1:1046079-1046101 CGCTACCAAGGTGAGGGGTGTGG + Exonic
900274773 1:1817757-1817779 CCCTCCCGAGGCTCCAGGTGTGG + Intronic
901041700 1:6368160-6368182 CCCTCCCCAGTTTGAAGGTGAGG + Intronic
902540824 1:17153242-17153264 CCCTGCCAGTGTTGGAGGTGCGG + Intergenic
903196205 1:21690358-21690380 GCTTCCCAAGGATGGAGGTGTGG + Intronic
903710839 1:25322969-25322991 CCATCACAAGGTGACAGGTGCGG + Intronic
903716107 1:25368460-25368482 CCATCACAAGGTGACAGGTGCGG - Intronic
903849875 1:26299709-26299731 CCCTACCAAGGTAACAGATGAGG - Intronic
906891292 1:49718123-49718145 GATTCCCAATGTTAGAGGTGGGG + Intronic
906913510 1:49982580-49982602 CCCTCCCCAGCTTGAAGGTGGGG - Intronic
907312373 1:53546265-53546287 CCCTGCCAAGGTTTGTGGCGTGG - Intronic
908319010 1:62963190-62963212 CACTCCCCGGGTGAGAGGTGAGG + Intergenic
909529980 1:76671269-76671291 GATTCCCAAGGTTGGAGGTGGGG - Intergenic
913157843 1:116117543-116117565 CCCTCCAAAGGTAAGAGTTGAGG - Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914884313 1:151572834-151572856 CCCTCCCAAGGTCAGAACTGGGG - Intronic
915327219 1:155086642-155086664 TCCTCCCATGGCTAGAAGTGGGG + Exonic
917627782 1:176863354-176863376 CCTGTCCAAGGTAAGAGGTGTGG + Exonic
918339508 1:183556538-183556560 CCCTGTCAAGGTTGGGGGTGGGG - Intronic
919110838 1:193217098-193217120 CCCTCCCAGGGCTTGCGGTGGGG + Intronic
919851357 1:201675121-201675143 TCATCCCCAGGTCAGAGGTGGGG - Intronic
919937372 1:202263552-202263574 TCCTCCCTAGGCTAGAGGAGAGG + Intronic
920131256 1:203733788-203733810 ACCTCCTAAGCTTAGATGTGAGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921194461 1:212741402-212741424 TAATCCCAATGTTAGAGGTGGGG + Intronic
923031273 1:230250746-230250768 GCCTCCCTAGGTTAGAGTGGAGG + Intronic
923119727 1:230978879-230978901 CCCGCCGTAGGTTAGAGGCGGGG - Intergenic
923278022 1:232415449-232415471 CACTCCCAGGGTAAGGGGTGAGG + Intronic
923755262 1:236785839-236785861 CCCTCCCCAGTTTGAAGGTGGGG - Intergenic
923767837 1:236909113-236909135 GACTCCCAATGTTGGAGGTGGGG - Intergenic
1067114047 10:43421027-43421049 CGCTGCCGAGGTCAGAGGTGCGG + Intergenic
1068903016 10:62291083-62291105 CACTCCCAGAGCTAGAGGTGGGG + Intergenic
1068981847 10:63070970-63070992 CTCTCCAAAGGCTAGAGGGGAGG - Intergenic
1070432576 10:76355966-76355988 GCCTCCCATCATTAGAGGTGAGG + Intronic
1070721456 10:78760085-78760107 CCCTCCCAAAGAAAGAAGTGGGG + Intergenic
1074464292 10:113667958-113667980 AGCCCCCAAGGTTAGGGGTGAGG - Intergenic
1076831367 10:132996079-132996101 CCCTCCAGGGGTCAGAGGTGAGG - Intergenic
1077541443 11:3148336-3148358 GCCTCCCCAGGTCAGGGGTGGGG - Intronic
1078516374 11:12026137-12026159 CTCTCCCAAGGTTGGGGCTGGGG + Intergenic
1078527609 11:12112058-12112080 CCCTCCCCATTTTAGAGATGGGG + Intronic
1078658530 11:13264848-13264870 CCCTAACAAGCTTTGAGGTGTGG - Intergenic
1079779820 11:24587394-24587416 CTCTTCCAAGGTGAGAGATGGGG + Intronic
1080391203 11:31848364-31848386 CTCTCCCAATGTTGGGGGTGGGG - Intronic
1081402461 11:42658952-42658974 CCCTTCCAAGGTTGGTGCTGAGG + Intergenic
1081664256 11:44907250-44907272 CCCTCCCAGGAGTAGAGCTGTGG + Intronic
1082128016 11:48455221-48455243 CACCCCCAATGTTGGAGGTGGGG - Intergenic
1082249402 11:49962196-49962218 CACCCCCAATGTTGGAGGTGGGG + Intergenic
1082561563 11:54626148-54626170 CACCCCCAATGTTGGAGGTGGGG - Intergenic
1083918466 11:65766054-65766076 CCACCCCAATGTTGGAGGTGGGG + Intergenic
1084007678 11:66331953-66331975 CCCTCCCCACGTCAGAGGTTGGG + Intronic
1085180704 11:74533680-74533702 GACTCCCAATGTTGGAGGTGGGG - Intronic
1085621922 11:78044181-78044203 CGCTCACCTGGTTAGAGGTGAGG - Intronic
1086508001 11:87526142-87526164 CCCTCTCAAGGTTATCTGTGAGG + Intergenic
1088251584 11:107865873-107865895 GATTCCCAAAGTTAGAGGTGGGG + Intronic
1089853927 11:121524017-121524039 CCCTCCCGAGGAGAGAGATGAGG + Intronic
1089949729 11:122514462-122514484 CCCTCCCAAGCTTTGATGTCTGG - Intergenic
1090202186 11:124864982-124865004 CCCTCCCAAGTCTAGGGGTTTGG - Intergenic
1090539976 11:127690826-127690848 CACCCCCAATGTTAGAAGTGGGG - Intergenic
1090799637 11:130162188-130162210 CCTTCCCAAGGCTGGTGGTGTGG + Intronic
1090972377 11:131654571-131654593 GACCCCCAAGGTTGGAGGTGAGG + Intronic
1091161319 11:133423716-133423738 GACTCCCAATGTTAGAGGTAGGG + Intronic
1096078900 12:48820846-48820868 CCATCCCAGGGTGAGAGGTCAGG + Intronic
1097173964 12:57132257-57132279 CCCTCCCTGGGAAAGAGGTGAGG + Intronic
1097503020 12:60430190-60430212 CCCTCCCAAGATAAGAGGGATGG - Intergenic
1098290867 12:68955942-68955964 CCGTCCCCAGCTTGGAGGTGGGG + Intronic
1098951583 12:76645343-76645365 CCCTCCCCAGCTTGAAGGTGGGG - Intergenic
1102025479 12:109712202-109712224 CCCTCCCCAGGCTGAAGGTGGGG - Intergenic
1104685659 12:130782553-130782575 CCCTGCTAAGGTAGGAGGTGAGG - Intergenic
1106850260 13:33782506-33782528 CCCTTCCCAGGTTGGAGGTGGGG - Intergenic
1106948954 13:34861370-34861392 GACTCCCAATGTTGGAGGTGGGG + Intergenic
1107329172 13:39279835-39279857 CATTCCCAAAGTTGGAGGTGGGG + Intergenic
1108824813 13:54399799-54399821 AATTCCCAATGTTAGAGGTGGGG + Intergenic
1111973596 13:94942420-94942442 CTATCCCAAGTTTACAGGTGAGG + Intergenic
1113875612 13:113592811-113592833 CCCTGCCCAGGTGACAGGTGTGG + Intronic
1113875653 13:113593051-113593073 CCCTGCCCAGGTGACAGGTGTGG + Intronic
1113875749 13:113593525-113593547 CCCTGCCCAGGTGACAGGTGTGG + Intronic
1113875792 13:113593722-113593744 CCCTGCCCAGGTGATAGGTGTGG + Intronic
1113875871 13:113594118-113594140 CCCTGCCCAGGTGATAGGTGTGG + Intronic
1113875960 13:113594555-113594577 CCCTGCCCAGGTGATAGGTGTGG + Intronic
1113970669 13:114185927-114185949 CCCTCCCCAGCTTGAAGGTGGGG - Intergenic
1116007173 14:39306561-39306583 AATTCCCAATGTTAGAGGTGGGG - Intronic
1119036165 14:71231764-71231786 CCCTCCCCAGTTTGAAGGTGGGG - Intergenic
1119308045 14:73623696-73623718 GCATCCCAATGTTGGAGGTGGGG + Intergenic
1121008148 14:90503612-90503634 CTCTCCCTAGGTTAGCGGTCAGG - Intergenic
1121241303 14:92431887-92431909 CCGTCTCAGTGTTAGAGGTGGGG + Intronic
1121738592 14:96235950-96235972 CAGTCCCATGGCTAGAGGTGGGG - Intronic
1126165900 15:45653585-45653607 CCCTCCCAAGGTTAGAGGTGGGG + Intronic
1126595673 15:50382435-50382457 CCCTCCCAGTGTTGGAGGAGGGG + Intergenic
1128977461 15:72164110-72164132 CCCTGCCAAGGTTAGGGCTTGGG - Intronic
1130610391 15:85355478-85355500 GCCTCCCAAGATTACAGGTGTGG + Intergenic
1130735954 15:86549113-86549135 AACTCCCAGTGTTAGAGGTGGGG - Intronic
1130738195 15:86571831-86571853 CCCTCCCTGGCTTAAAGGTGGGG + Intronic
1131748545 15:95478538-95478560 CCCTCCCAAGGTCAGAGACTGGG + Intergenic
1132603344 16:783556-783578 CTCTCCCAAGATGAGAGCTGGGG - Intergenic
1134108644 16:11501075-11501097 CCCTCCCAAGGTGTGAGGGTGGG - Intronic
1136926990 16:34383474-34383496 CCCTCCAAAGGTCAGGTGTGGGG + Intergenic
1136977584 16:35028333-35028355 CCCTCCAAAGGTCAGGTGTGGGG - Intergenic
1137897942 16:52234455-52234477 CCATTTCAAGGTTGGAGGTGGGG - Intergenic
1138631295 16:58296031-58296053 CCTGCCCAGGGTTAAAGGTGAGG - Intronic
1139700963 16:68707760-68707782 CCCTCTCCAAGTTAGAGGTGGGG + Intronic
1140717934 16:77743618-77743640 CCCTCCCTGGGTGGGAGGTGGGG + Intergenic
1140827036 16:78716296-78716318 CCCTCCAAAGGCTGGAGGGGAGG - Intronic
1142160789 16:88556342-88556364 CATTCCCAAGGTTAGGGGAGGGG + Intergenic
1144146543 17:12404572-12404594 ACCTCCCCAGGTTACAGGTGAGG - Intergenic
1144702406 17:17348134-17348156 CTCTCCAAAGGTTAGTGGGGAGG - Intergenic
1144839764 17:18178707-18178729 CCACCCCAAGGTAAGAGCTGGGG + Intronic
1144937400 17:18911199-18911221 CCCACCCATGGTCAGAAGTGTGG + Exonic
1145415457 17:22710559-22710581 CCCTGCCAAGGTCACAGATGTGG - Intergenic
1146538793 17:33676830-33676852 CCCTCCCATTGTTGGGGGTGGGG + Intronic
1146919125 17:36698202-36698224 CCCTCCCGAGGGGAGAGCTGGGG + Intergenic
1148619435 17:49023132-49023154 TCCTCACAAGGGTAGATGTGGGG + Intronic
1149004367 17:51789805-51789827 CCCTTACAAGGGTAAAGGTGAGG - Intronic
1149264641 17:54914192-54914214 TCCACCCAAGGTTGGAGATGTGG + Intronic
1149512333 17:57254392-57254414 CCCTCACAAGGCGAGAGTTGGGG - Intergenic
1151676844 17:75603056-75603078 CCTTTCCAGGGTTAGGGGTGAGG - Intergenic
1151988343 17:77558166-77558188 CCCTCCCCAGGTGGAAGGTGAGG + Intergenic
1153982193 18:10320100-10320122 CCCTTCCAAGGTTAGCAGAGAGG + Intergenic
1156468231 18:37361626-37361648 CCCACCCAAGTGTGGAGGTGGGG + Intronic
1157432817 18:47643744-47643766 TGATCCCAATGTTAGAGGTGGGG + Intergenic
1157931245 18:51825870-51825892 GACTCCCAATGTCAGAGGTGGGG - Intergenic
1158440639 18:57471394-57471416 CTCTCTCCAGGTTAGAGGTGGGG + Intronic
1158503026 18:58020958-58020980 CCCACACAAGGTAGGAGGTGTGG - Intergenic
1160841784 19:1149636-1149658 CCCACCCAAGGCTTGTGGTGTGG + Intronic
1161284090 19:3459904-3459926 CCCAACTGAGGTTAGAGGTGGGG - Intronic
1163272511 19:16262700-16262722 CCCTCCCACGGGTAGCGGTGGGG - Intergenic
1163760370 19:19133093-19133115 CCCTCCCAAGGCTGGGGCTGGGG + Intronic
1165001114 19:32763390-32763412 CCCACATAAGGTGAGAGGTGAGG - Intronic
1165381908 19:35487699-35487721 CTTTCCTAAGGTAAGAGGTGTGG - Exonic
1166146455 19:40840076-40840098 AGCTCCCAATGTTGGAGGTGGGG + Intronic
1166159142 19:40938595-40938617 CACTCCCAGAGTCAGAGGTGGGG + Intergenic
1166168089 19:41006531-41006553 CACTCCCAGAGTCAGAGGTGGGG + Intronic
1166210712 19:41305034-41305056 CCCTTCCAAGGTTTGTTGTGAGG + Intronic
1168075367 19:53978423-53978445 CCGCCCCAAGGTGAGAGGAGGGG - Intronic
1168269408 19:55241464-55241486 GCCTCCCAAGGTCAGGGGTGTGG - Exonic
1168638436 19:58014123-58014145 CCATCACAAGGTGATAGGTGCGG + Intergenic
926982997 2:18591403-18591425 GACTCCCAATGTTGGAGGTGAGG - Intergenic
927839678 2:26431817-26431839 CCATCCGAAGGATTGAGGTGGGG + Intronic
928051550 2:28001871-28001893 AACTCCCAATGTTGGAGGTGGGG - Intronic
929014552 2:37481614-37481636 CCCTCCCCAGCTTGAAGGTGGGG - Intergenic
930645079 2:53897535-53897557 CTCTCCAAGTGTTAGAGGTGAGG - Intronic
932659467 2:73639899-73639921 GACCCCCAATGTTAGAGGTGGGG + Intergenic
932701561 2:73995839-73995861 CACACCCAAGGTAAGTGGTGAGG + Intronic
934713595 2:96530693-96530715 CCCTCCCGAGGTTCCTGGTGGGG - Intergenic
934769766 2:96900332-96900354 CCCTCCCAAGGTCTCAGCTGGGG + Intronic
936519832 2:113204771-113204793 CCCTCCTAAGGAAAAAGGTGCGG - Intronic
941900483 2:170673258-170673280 CCTGCCCAAGGTTAGAAGAGTGG - Intergenic
942101528 2:172588969-172588991 CCCTCTCAAGGTTGGAGGGCAGG - Intronic
942812373 2:180014186-180014208 CCCGACCAAGGTTGGAGGTGGGG + Intergenic
942884523 2:180907062-180907084 CCCTCTCAATGTTTGAGTTGGGG - Intergenic
943032462 2:182701635-182701657 GCCTCCCAAAGTTACAGGTGTGG + Intergenic
944057006 2:195532926-195532948 CCCTTCCAAGGTTAGAAGTTAGG - Intergenic
945561911 2:211350050-211350072 GACCCCCAATGTTAGAGGTGGGG + Intergenic
948981522 2:241497143-241497165 CCCTCCCCAGGCTCCAGGTGGGG + Intronic
1170683439 20:18547267-18547289 CCATCCCTAGTTTACAGGTGAGG - Intronic
1171293420 20:23995500-23995522 CGCTCCCAAGGTGGGAGGAGTGG - Intergenic
1173235861 20:41244865-41244887 CCTTCCAAGGGTGAGAGGTGAGG - Intronic
1174506662 20:51021932-51021954 CCTTCTCAAGGTGGGAGGTGTGG - Intronic
1176092400 20:63325088-63325110 CCCTCCCAGGGTGAGCAGTGAGG + Intronic
1176383919 21:6127623-6127645 TCCTCCCAAGATCAGAGGTGGGG - Intergenic
1178205113 21:30455934-30455956 GATTCCCAAGGTTAGAGGTGGGG - Intergenic
1179141154 21:38726591-38726613 GACTCCCAATGTTGGAGGTGGGG - Intergenic
1179739555 21:43410615-43410637 TCCTCCCAAGATCAGAGGTGGGG + Intergenic
1181501301 22:23317085-23317107 CGCTCCCAAGGTGGGAGGAGTGG + Exonic
1183601920 22:38844660-38844682 CCTTCAGAAGGTTGGAGGTGGGG - Intergenic
1184035441 22:41915673-41915695 CCCTCCCCAGGTGTGAGGAGAGG + Intergenic
1184450773 22:44581289-44581311 CACTCCAAAGGCTAGAGGGGAGG - Intergenic
1184474401 22:44712728-44712750 CCCCTCCAAGGTGAGAAGTGTGG + Intronic
949165429 3:935034-935056 GATTCCCAAGGTTGGAGGTGAGG - Intergenic
949324011 3:2843521-2843543 ACCCCCCAATGTTGGAGGTGGGG + Intronic
952408530 3:33026524-33026546 CCCTCCCCAGCTTGAAGGTGGGG - Intronic
953721188 3:45356643-45356665 CCCTCCCCAGATTCGAGGAGAGG + Intergenic
954583618 3:51716895-51716917 CCTTCCCCAGGACAGAGGTGTGG + Intronic
954590703 3:51779055-51779077 TCCTCCCAAGATCAGAGATGGGG - Intronic
956765777 3:72483050-72483072 CCTTCCCGAGGTGAGGGGTGGGG + Intergenic
956861510 3:73328506-73328528 CATTCCCAATGTTGGAGGTGGGG - Intergenic
958557819 3:95703122-95703144 AACTCCCAATGTTAGAGGTGGGG + Intergenic
959529191 3:107413289-107413311 CCCTCGCCATGCTAGAGGTGGGG + Intergenic
959903178 3:111682770-111682792 CCCTCCCCAGGTTCGAGTTTAGG + Intronic
960250229 3:115443419-115443441 GACCCCCAATGTTAGAGGTGGGG - Intergenic
960996402 3:123343373-123343395 CCCACCCCATGTTACAGGTGAGG + Intronic
961539006 3:127587992-127588014 CCCTCCCAGGGTTGGAGGCCAGG - Intronic
961669384 3:128517912-128517934 CCCTCCTAAGGGTGGATGTGTGG - Intergenic
962317952 3:134370569-134370591 CCCTTCTCAGGTTGGAGGTGGGG + Intronic
962814168 3:138983604-138983626 CCCTCCCAAACTAAGAGGTGGGG - Intergenic
965767308 3:172144315-172144337 GACTCCCAACGTTGGAGGTGGGG - Intronic
965813432 3:172614362-172614384 CCCTCCCCGGCTTAAAGGTGGGG + Intergenic
965990260 3:174809801-174809823 CAATCCCAATGTTGGAGGTGGGG + Intronic
966833133 3:184028194-184028216 CCCTCCCAATTTTAGAGATAAGG + Intergenic
967801340 3:193664559-193664581 CCTTCCCCTAGTTAGAGGTGAGG - Intronic
967805654 3:193712504-193712526 CCATCCCATGGTTACAGCTGGGG + Intergenic
967864324 3:194177870-194177892 CCCTCCCAGGGTTGCAGGGGTGG - Intergenic
968652256 4:1764914-1764936 CCCTCGCAGGGCTGGAGGTGGGG - Intergenic
971972722 4:33641002-33641024 CCATCCCATGGTTAGAGCTTGGG - Intergenic
974188220 4:58467321-58467343 CCCTCCCAAGCTCAGAGCTAAGG + Intergenic
974260301 4:59517980-59518002 CCCTCCCCAGCTTAAAGGTGGGG + Intergenic
974316955 4:60294808-60294830 CATCCCCAATGTTAGAGGTGAGG - Intergenic
974683510 4:65195075-65195097 CCCTCCCCAGCTTGAAGGTGGGG + Intergenic
974996055 4:69160424-69160446 AATTCCCAATGTTAGAGGTGGGG - Intronic
975040874 4:69743512-69743534 CCCTCCCCAGCTTGAAGGTGGGG + Intronic
975254363 4:72216295-72216317 CCCTCCCCAGCTTGAAGGTGGGG + Intergenic
975321301 4:73012076-73012098 CCCTCCCCAGCTTGAAGGTGGGG - Intergenic
980493096 4:133555175-133555197 GCCACCCAAGGTAAGGGGTGTGG - Intergenic
982188954 4:152834219-152834241 GATTCCCAATGTTAGAGGTGGGG - Intronic
983979863 4:173982414-173982436 GACTTCCAATGTTAGAGGTGGGG + Intergenic
984872035 4:184334130-184334152 ATCTCCCAGTGTTAGAGGTGAGG - Intergenic
985024388 4:185725505-185725527 TACTCCCAAGTTTATAGGTGAGG - Intronic
985485172 5:144817-144839 CCCTCCCCAGGAAAGAGGTCCGG + Exonic
989497985 5:42131725-42131747 TCATCCCAATGTTGGAGGTGGGG - Intergenic
991216995 5:64166317-64166339 CCCTCTCCAGGTCTGAGGTGGGG + Intronic
992189464 5:74276961-74276983 CCCTTCCAAGGAGAGGGGTGAGG + Intergenic
1001156024 5:169273067-169273089 CCTTCCCAAGGGCTGAGGTGTGG - Intronic
1001544039 5:172558933-172558955 CTGTCCCCAGGTTACAGGTGAGG - Intergenic
1002218131 5:177654623-177654645 AATCCCCAAGGTTAGAGGTGGGG + Intergenic
1003130693 6:3392988-3393010 CCCTCCAAAGGTTGGATCTGGGG - Intronic
1004151279 6:13122358-13122380 CCCTCCCAAGGGAAGAGATGTGG + Intronic
1004209228 6:13621082-13621104 CTCTCCCCGGGTTAGAGGGGTGG + Exonic
1007080915 6:39103198-39103220 CCTGCCCAAGGTTGGGGGTGGGG + Intergenic
1007303859 6:40889455-40889477 CCCCACCAAGATGAGAGGTGGGG + Intergenic
1009231669 6:61070571-61070593 GATTCCCAATGTTAGAGGTGGGG + Intergenic
1009290077 6:61870034-61870056 CCCTCCCCAGGAAAGGGGTGGGG + Intronic
1010191909 6:73204381-73204403 CCTTCCCAGAGTTAGAGGTGGGG + Intergenic
1010260643 6:73811976-73811998 CCCTCCCATGGGCAGAGGTGAGG + Intronic
1011354731 6:86462315-86462337 CCCTCCCCAGGTGAGAGGCAGGG - Intergenic
1014399944 6:120975893-120975915 CCCTTCCAAGGTAAGATGGGAGG + Intergenic
1017484827 6:154892769-154892791 CACTCCAGAGGTCAGAGGTGGGG + Intronic
1017958097 6:159196192-159196214 CCCTCCCAACTCCAGAGGTGAGG - Intronic
1019635169 7:2071616-2071638 CCTTCCCCAGCTTAGGGGTGGGG - Intronic
1020013231 7:4817533-4817555 CCCTCCCCAGGTAAGAGTGGCGG - Intronic
1021200899 7:17727629-17727651 CTCTCCCTCGGTTAGAGGTTGGG - Intergenic
1023841009 7:44097425-44097447 CCCTGCCAAGGTTAGGGTTAGGG - Intergenic
1024200044 7:47097260-47097282 TACTCCCAGGGTTGGAGGTGTGG - Intergenic
1024255933 7:47539990-47540012 GCCACCCAAGTTTTGAGGTGAGG - Intronic
1024916508 7:54505990-54506012 TGCTCCCAAGGTTAGTGCTGAGG - Intergenic
1025959019 7:66204749-66204771 CCCTCCCAACCACAGAGGTGGGG - Intergenic
1026679175 7:72452323-72452345 GACCCCCAATGTTAGAGGTGGGG + Intergenic
1029497179 7:100902288-100902310 CCCTTCCAAGGAGAGAGGTGTGG + Intergenic
1030570272 7:111213467-111213489 CCCTCCCCAGCTTGAAGGTGGGG - Intronic
1030820621 7:114087056-114087078 TCCTCCCGAGGTTGGGGGTGGGG - Intronic
1031643147 7:124190289-124190311 CCCCACCAATGTTGGAGGTGGGG - Intergenic
1032702130 7:134391546-134391568 AACTCCCAATGTTGGAGGTGGGG - Intergenic
1034502187 7:151457995-151458017 GATCCCCAAGGTTAGAGGTGGGG - Intergenic
1035402260 7:158574570-158574592 CCTTCCTAAGGTTAGATGTGGGG + Intronic
1035434572 7:158849942-158849964 CCCTCCCTGGCCTAGAGGTGGGG + Intergenic
1037150229 8:15626948-15626970 CCCTCCCAAGCTTGAAGGTGGGG - Intronic
1037319054 8:17627010-17627032 GCCTGCCAAGGTTAGCGGAGGGG - Intronic
1040843293 8:51807440-51807462 AACTCCCAATGTTGGAGGTGGGG - Intronic
1043987250 8:86708232-86708254 CCCTTTCAAGTTTAGAGGTTGGG + Intronic
1044708409 8:95031077-95031099 CCCCCACAATGTTGGAGGTGGGG - Intronic
1045508281 8:102794231-102794253 CCCTCCCAGAGGAAGAGGTGAGG + Intergenic
1051029621 9:12658568-12658590 CCCTCCCCAGCTTAAAGGTGGGG + Intergenic
1053480609 9:38413873-38413895 CCCTTCCAAGGGGAGAGGTTTGG + Intronic
1053482934 9:38429411-38429433 ACCTCCCAAGGTTTGTGGGGAGG + Intergenic
1056817361 9:89811637-89811659 CCCTCCCCAGGTATGAGGTGTGG + Intergenic
1057481117 9:95446677-95446699 CCCTCCGCAGGTTAGCAGTGGGG + Intronic
1058046460 9:100362975-100362997 GATTCCCAATGTTAGAGGTGGGG + Intergenic
1058767672 9:108197851-108197873 CCTTGCCAGGGTTAGAGGAGGGG - Intergenic
1060453593 9:123767215-123767237 GTATACCAAGGTTAGAGGTGGGG + Intronic
1060797426 9:126522213-126522235 CCCTCCCAGGGAGAGAGGCGTGG - Intergenic
1062122621 9:134841878-134841900 CCCTCCCAAGGCTTCAGGGGTGG - Intronic
1062540004 9:137037378-137037400 CCAGCCCAAGGTCACAGGTGAGG + Exonic
1189427010 X:40910714-40910736 CCCCCCCAGTGTTGGAGGTGGGG - Intergenic
1190378033 X:49810042-49810064 CCCCTCCAAGGTCAGTGGTGGGG + Intergenic
1193627278 X:83837049-83837071 TACCCCCAATGTTAGAGGTGCGG - Intergenic
1195766137 X:108298472-108298494 ACCTCCCAGGGTCAGTGGTGAGG - Intronic
1197609556 X:128623275-128623297 CCCTCCCTGGCTTAAAGGTGGGG + Intergenic
1199460186 X:148075522-148075544 CCCTCCAAAGGTTCTAGGGGAGG - Intergenic
1199931389 X:152526641-152526663 ACCTGCCATTGTTAGAGGTGAGG - Intergenic