ID: 1126167274

View in Genome Browser
Species Human (GRCh38)
Location 15:45664377-45664399
Sequence AGCCATCTTCAAATAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 8, 3: 29, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126167274_1126167275 5 Left 1126167274 15:45664377-45664399 CCTTCAGCTATTTGAAGATGGCT 0: 1
1: 1
2: 8
3: 29
4: 222
Right 1126167275 15:45664405-45664427 GTTTTATGTAAATTTTCTCTAGG 0: 1
1: 0
2: 4
3: 37
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126167274 Original CRISPR AGCCATCTTCAAATAGCTGA AGG (reversed) Intronic
900889206 1:5437261-5437283 AGACATTTTCTAACAGCTGAGGG + Intergenic
900927409 1:5714269-5714291 AGCCATCTTCAGACAGCTGTGGG - Intergenic
902868291 1:19295695-19295717 AATCATTTTTAAATAGCTGAAGG + Intergenic
904413420 1:30339579-30339601 AGCCATCTTCAAACATTGGAAGG + Intergenic
905116809 1:35648600-35648622 TGCCACCTTCAAATATGTGAAGG + Intergenic
905422191 1:37855203-37855225 CATGATCTTCAAATAGCTGATGG + Intronic
906964656 1:50444410-50444432 AGCCCTCTTTGAATATCTGAAGG + Intronic
907353173 1:53850223-53850245 AGCTGTCTTCAAACATCTGAAGG + Intergenic
908964032 1:69736668-69736690 ATTCATATTCAAATAGGTGATGG - Intronic
909388246 1:75085681-75085703 AGCAATCTTCAAAGATCTGAAGG - Intergenic
909437230 1:75656101-75656123 TGACATCTTCAAAGTGCTGAAGG + Intergenic
909954303 1:81758883-81758905 ACCTATCTTCAAATATTTGAAGG - Intronic
910370226 1:86507713-86507735 AGCCTTCTTGAAATTGCTGAAGG - Intergenic
910845492 1:91601250-91601272 CGCCATCAACAAAGAGCTGAGGG - Intergenic
912227872 1:107756161-107756183 AGACATTTTAAAATAGGTGAAGG - Intronic
913042701 1:115042778-115042800 AGACATATTCAAAGTGCTGAAGG + Intergenic
913355025 1:117911051-117911073 GTCCATCTTCAAATATCTGAAGG - Intronic
913368533 1:118070137-118070159 AGCCAACTTCAACTTGTTGAAGG + Intronic
913707696 1:121443512-121443534 AGCCTCCTTCAATCAGCTGAAGG + Intergenic
916468063 1:165092282-165092304 AGCCATCTTCCAAGAGGTGCAGG + Intergenic
916912943 1:169370874-169370896 GGCCATCTTCACATAGCTGTAGG + Intronic
918384836 1:183994981-183995003 AGCCAGGATTAAATAGCTGAAGG - Intronic
920887198 1:209940727-209940749 AGCTGTCTTCAAATGGCAGAAGG - Intronic
1063235615 10:4112444-4112466 AGCCATGATCAAAAAGCTGTTGG - Intergenic
1064881460 10:20059446-20059468 AAACATTTTCAATTAGCTGATGG - Intronic
1065407302 10:25383299-25383321 AGCCTTATTCAAAAAGCAGATGG - Intronic
1066197975 10:33119953-33119975 CGACATCTTCAAATATGTGAAGG + Intergenic
1066308917 10:34176454-34176476 AGACAGCCTCAATTAGCTGATGG + Intronic
1066583436 10:36905767-36905789 ATCCTTCTTCAAAAAGATGAGGG + Intergenic
1067679043 10:48415571-48415593 AGCTAACTTCAAAAGGCTGAAGG + Intronic
1068817838 10:61337503-61337525 AGCTATCTTCAAATACCTGAAGG - Intergenic
1068925207 10:62528502-62528524 AGTTGTCTTCAAATAGCTAAAGG - Intronic
1071141272 10:82511917-82511939 AGGCATATTCAAATTGCAGATGG + Intronic
1073007249 10:100334062-100334084 AGCCATGTGCAGATAGTTGAAGG + Intergenic
1074992825 10:118725955-118725977 GGGCATCTTAAAATAGCTGTGGG - Intronic
1077004111 11:343384-343406 AGGCATCTTCACATAGGTAAGGG - Intergenic
1079100399 11:17538140-17538162 CACCATCTACAAATAGCTGTTGG + Intronic
1079676366 11:23231888-23231910 AGCCATCTTAAAATATTTTAGGG - Intergenic
1080101657 11:28466706-28466728 AACAATTTGCAAATAGCTGAGGG - Intergenic
1080362368 11:31530710-31530732 AGCTGTCTTCAAATATCTGTTGG - Intronic
1081589244 11:44409489-44409511 AGCCAGCTTCAAAGAGCTGTGGG + Intergenic
1081677556 11:44979791-44979813 AGTCATCACCAAGTAGCTGATGG + Intergenic
1084324012 11:68388630-68388652 AACCTTCTGCACATAGCTGAAGG - Intronic
1085491407 11:76921853-76921875 TGCTATCTTCAAATATCTGAAGG - Intronic
1086910305 11:92464356-92464378 TACCATCTTCAAATATCTGAAGG + Intronic
1088364314 11:109022933-109022955 AGCCCTCTTAACCTAGCTGAAGG + Intergenic
1088549875 11:111001838-111001860 AGCCATCAACCAATACCTGATGG - Intergenic
1089608419 11:119655640-119655662 AGCCATCTTCCAATATTTGAAGG + Intronic
1090880306 11:130826901-130826923 AGCTATCTTCAAAGATCTGAAGG + Intergenic
1093733640 12:22594130-22594152 AGCTATCTTCAGATATTTGAAGG - Intergenic
1093860567 12:24161330-24161352 AGCTATCTTCAAATATCTGATGG - Intergenic
1094136663 12:27134524-27134546 AGTCATCTTCAAAGAGCTCATGG + Intergenic
1094186331 12:27646960-27646982 TGTCATCTTCAAAGAGCTCATGG + Intronic
1094376540 12:29795978-29796000 AGCCATCTTCCACTGGCTCAGGG - Intergenic
1096945437 12:55402429-55402451 ATCCACCATCAAATAGATGAAGG + Intergenic
1097026855 12:56062822-56062844 AGACATTTTCAAAGATCTGAAGG + Intergenic
1098550739 12:71758400-71758422 AGCTATCTTCAACTATCAGAAGG - Intronic
1100431942 12:94538761-94538783 AGCCAGCATCAAATGGATGAGGG - Intergenic
1100935802 12:99664510-99664532 TGGCATTTTCAAAAAGCTGAGGG + Intronic
1102380664 12:112463809-112463831 AGCTATATCTAAATAGCTGATGG + Intronic
1103265265 12:119624405-119624427 AGCCATCTATCAACAGCTGAAGG + Intronic
1104809080 12:131609754-131609776 AGCCTTCCTCAAAAAGCTGCTGG - Intergenic
1105800017 13:23894848-23894870 AGCCACCTTCAACCCGCTGACGG - Intronic
1105849017 13:24318151-24318173 AGCCACCTTCAACCTGCTGACGG + Intronic
1106314033 13:28577938-28577960 CCCCATCTTCAAAGAGCTGGCGG - Intergenic
1109868576 13:68300870-68300892 AGCTATTTTTAAATATCTGAGGG - Intergenic
1109976165 13:69835352-69835374 GGGCATAGTCAAATAGCTGAAGG + Intronic
1111493086 13:89010979-89011001 AGCTATCATCAATTAGCTGGTGG + Intergenic
1111809029 13:93074718-93074740 AGCCATCTTCAAATATTTAAAGG - Intergenic
1111829653 13:93311337-93311359 AGCTATATTCAAATAGCTCAAGG - Intronic
1113710726 13:112462975-112462997 AGACATCCTCAGATAGGTGAAGG + Intergenic
1116055953 14:39864069-39864091 TGCTATCTTCAAATATTTGAAGG + Intergenic
1116122584 14:40739250-40739272 AACCATCTTCACATAGCAGCAGG + Intergenic
1116423324 14:44759778-44759800 AGCCATCATCTAATCGCTTAAGG + Intergenic
1118677116 14:68199020-68199042 AGCTATCTACGAATAGCTGGAGG - Intronic
1119232659 14:72993142-72993164 AGTCATCTTCAAAGCCCTGAAGG - Exonic
1120101419 14:80449682-80449704 AGCCTTCTTCAAATGGCAGCAGG - Intergenic
1123395161 15:19926642-19926664 AGCCATTTTGAAATATATGAAGG + Intergenic
1124149574 15:27165488-27165510 AGCAATCTTCAAATATTTGAAGG - Intronic
1126167274 15:45664377-45664399 AGCCATCTTCAAATAGCTGAAGG - Intronic
1126497900 15:49312754-49312776 AGCTGTCTTCAGATATCTGAAGG + Intronic
1127276134 15:57445778-57445800 AGAAAACTACAAATAGCTGAGGG - Intronic
1127405284 15:58638122-58638144 AGCCATCTTCTAAGAGCTGCTGG - Intronic
1127727284 15:61762243-61762265 AATTATCTTCAAATAGTTGAAGG - Intergenic
1127746328 15:61979233-61979255 AGGGATCTTCAAAAAGTTGATGG + Intronic
1130864466 15:87920582-87920604 AGCCATCTTCATATAGCAAGTGG - Intronic
1130892771 15:88147572-88147594 ATACATCTGCTAATAGCTGAGGG + Intronic
1131848575 15:96514006-96514028 AGCCATCTTCAAATATTAAACGG + Intergenic
1134211525 16:12281425-12281447 AGCCCTCTTTAAATGGCTGGTGG + Intronic
1135657069 16:24259643-24259665 AGCTGTCTGCAAATATCTGAAGG + Intronic
1140310661 16:73845130-73845152 AGTCATTTTGAAATAACTGAAGG + Intergenic
1140933386 16:79648958-79648980 AGCTGCCTTTAAATAGCTGAGGG - Intergenic
1141566509 16:84906025-84906047 AACCATCTTTGATTAGCTGAAGG + Intronic
1141945665 16:87307865-87307887 GTCCATCTTGAAAGAGCTGAGGG + Intronic
1144384013 17:14731901-14731923 AGCTCTCCTCAAACAGCTGAGGG - Intergenic
1146364660 17:32212778-32212800 GGCCGTCTTCAAATGCCTGAAGG - Intronic
1147489364 17:40850190-40850212 AGTTATCTTAAAATGGCTGATGG - Intergenic
1148855909 17:50579246-50579268 AGCTGTCTTCAAATATTTGAAGG + Intronic
1149925291 17:60696652-60696674 AGGCATCTTCAGGTAGCTAAGGG - Intronic
1151627328 17:75285251-75285273 GGCCATCTTCAGTTGGCTGAAGG - Intronic
1151931344 17:77233769-77233791 AGCCATCATCAAGAAGCAGAAGG - Intergenic
1153081057 18:1225691-1225713 ACACATCTTCAAATATCTTAAGG - Intergenic
1155115834 18:22765770-22765792 AACACTCTTCAAATAGCTGAGGG + Intergenic
1155178913 18:23326060-23326082 AGCCATCTCCAAAATGCTGGGGG + Intronic
1156919994 18:42510198-42510220 AGCAATCTTCATATAGCTGAAGG + Intergenic
1157316100 18:46591443-46591465 AGCCACATTCAAATAGCCAAAGG - Intronic
1158094718 18:53757732-53757754 CCCCATCTTCACATAGCAGAAGG + Intergenic
1158326430 18:56318462-56318484 AGCAGTCTTAAAATATCTGAGGG - Intergenic
1159791786 18:72790759-72790781 AGCAATCTTCAAACATTTGAAGG - Intronic
1159807568 18:72974483-72974505 AACCATCTTTACAAAGCTGAAGG - Intergenic
1163643927 19:18477609-18477631 GGGCATCTTCAAAGTGCTGAGGG + Intronic
1164453480 19:28386727-28386749 AGCCTTCTTCACCTTGCTGAGGG - Intergenic
1164624940 19:29720963-29720985 AACCATCTACAAATATTTGAAGG - Intergenic
1166467848 19:43049185-43049207 AGCCATCTACAAATACCAAAGGG - Intronic
1167126201 19:47550630-47550652 AGACGTCTTCAAATATCTGAAGG + Intronic
925417601 2:3681937-3681959 ACCCATCTGCAAATGGCTGCTGG + Intronic
926402172 2:12508714-12508736 AGCAATATTCAAACAGATGATGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927212960 2:20649918-20649940 ATCCATCTGCACATGGCTGAGGG + Intronic
927512404 2:23652462-23652484 TGCCATCCTCCAAAAGCTGAAGG - Intronic
928336498 2:30402861-30402883 AGCCATCTTCATAAGGCTGGTGG + Intergenic
928945841 2:36771084-36771106 AGCCTTCTCCAAATACCTTAAGG - Intronic
929189058 2:39122844-39122866 AGCCCTCTTCAAATATTTAAAGG + Intronic
929393062 2:41494118-41494140 AACCATTTTTAAATGGCTGAAGG - Intergenic
931265549 2:60657014-60657036 ACCCATATTCACAAAGCTGATGG - Intergenic
931508708 2:62963029-62963051 ATCCATCTTTAAAGACCTGAAGG + Intronic
931678923 2:64726630-64726652 ATACATTTTCAAAGAGCTGATGG - Intronic
931704421 2:64935487-64935509 AGCTGTCTCCAAATATCTGAGGG - Intergenic
933828546 2:86186992-86187014 GGCCATCTGCAAATACCTGGTGG + Intronic
935483548 2:103623725-103623747 AGAGATCTTCACATAGATGAGGG - Intergenic
935650879 2:105381039-105381061 AGCCACCTTCCATTAACTGAGGG - Intronic
937438111 2:121895959-121895981 AGCCATCTTCAGATACCCAAAGG - Intergenic
938762375 2:134437401-134437423 TGACATCTACAAACAGCTGAGGG - Intronic
940864172 2:158800659-158800681 AGCCATCTTCAAAGATCTGAAGG - Intronic
942065003 2:172262515-172262537 AGCCATGTTAAAATAACTTAAGG - Intergenic
942331792 2:174833436-174833458 CGACATCTTCAAAGAACTGAAGG - Intronic
942886732 2:180934532-180934554 AGCTGTCTTCAAATATCTAAAGG - Intergenic
944520123 2:200557096-200557118 AGCCATCTGCAAACAGTGGAAGG + Intronic
945857685 2:215087981-215088003 AGCCACTTTCAATGAGCTGAAGG - Intronic
946095060 2:217267362-217267384 GGCCATCATCAAATAACTAATGG + Intergenic
946485358 2:220095916-220095938 AGCAATCTCCAAACAGCCGAGGG - Intergenic
947723997 2:232386337-232386359 AGCCTTCTTGTAATTGCTGAAGG + Intergenic
948675764 2:239595708-239595730 AGGCATCTTCCAATGCCTGATGG - Intergenic
1168885875 20:1254527-1254549 AGCCATCTGGAAGCAGCTGAAGG + Intronic
1171329113 20:24321877-24321899 AACCACCTTGAAATAACTGAAGG + Intergenic
1172584813 20:36075622-36075644 AGCAATCTTGGAATATCTGAAGG + Intergenic
1173596361 20:44261029-44261051 AGGCACCTTCAAATGGCTCAGGG - Intronic
1173773036 20:45680369-45680391 AGGCATCTTCACATGGCTGGAGG - Intergenic
1175163931 20:57029748-57029770 AGCCAACTTCAAATATCACAGGG + Intergenic
1177316373 21:19467162-19467184 AGCTATTTTTAAAAAGCTGAAGG + Intergenic
1178230701 21:30780950-30780972 AGCCATTTGCAATTAGCTGCTGG - Intergenic
1178428533 21:32498987-32499009 AGCCATTTTCACATAGTAGAAGG + Intronic
1178761534 21:35407143-35407165 AGCCATATACAAATAACTGATGG + Intronic
1182594916 22:31411877-31411899 AGCGTTCTTCAAATTTCTGAGGG - Intronic
1182771635 22:32801122-32801144 AGCCAGCTGCAAACAGCAGATGG + Intronic
949181612 3:1137982-1138004 AGTCATCTTCAAATATTTGAAGG - Intronic
950829968 3:15863664-15863686 AGGCATCTTCAAAAAGTTCATGG - Intergenic
951527141 3:23664382-23664404 TGCCATCTTCCAATACCTGAAGG - Intergenic
952174403 3:30845994-30846016 AGCTATCTTTAAGTACCTGAGGG + Intronic
953426910 3:42803388-42803410 AGCCATTTTAAACAAGCTGATGG - Intronic
955983714 3:64551865-64551887 AGCCCTCTTCAAATAGCTGAAGG - Intronic
956861436 3:73327745-73327767 AGTCTTCATCAGATAGCTGAAGG - Intergenic
957963206 3:87287712-87287734 AGCAATATTCAAATATATGATGG + Intergenic
958036239 3:88173292-88173314 AGGCATCTTCAACTTGCTCATGG - Intergenic
959479186 3:106850543-106850565 TAACATCTTCAAACAGCTGAAGG + Intergenic
960313242 3:116142636-116142658 AGCTGTCTTCAACTATCTGAAGG - Intronic
960384511 3:117005478-117005500 AGCCAAATTCAAATACATGAAGG + Intronic
961953503 3:130775147-130775169 AGTGTTCTTCAAATTGCTGAAGG - Intergenic
962356288 3:134697147-134697169 AGCTATCTTCAAATGTTTGAAGG + Intronic
962432678 3:135334678-135334700 AGGCTTCTGGAAATAGCTGATGG - Intergenic
966439521 3:179928400-179928422 AGCCATTTACAAATGGCTGAGGG + Intronic
967210792 3:187166694-187166716 TACCATCTTCAGATATCTGAAGG + Intronic
967555654 3:190854820-190854842 CTGCATGTTCAAATAGCTGAGGG - Exonic
969352322 4:6604847-6604869 AGCTATCTTCAGGTCGCTGAAGG + Intronic
971284650 4:25276104-25276126 AGATATTTTCAAATACCTGAAGG + Intronic
972143007 4:35984832-35984854 AGACATATTTAAATTGCTGAAGG + Intronic
976519766 4:86013148-86013170 AGCCATTTTCAGATAGTTAAAGG + Intergenic
977037535 4:91974438-91974460 TGACATCTTCAAAGTGCTGAAGG - Intergenic
977228421 4:94422412-94422434 AGCCTTCTTCCAATCTCTGATGG - Intergenic
979161511 4:117467490-117467512 AGCCATTATCAGATAGCTAAAGG + Intergenic
979402852 4:120271744-120271766 AGATATGTTGAAATAGCTGACGG + Intergenic
979823905 4:125209281-125209303 AACCATGTTCAAATAAATGATGG - Intergenic
981991918 4:150931784-150931806 AGCTATATTCAAATATCTGGGGG + Intronic
983840063 4:172446819-172446841 AGACATCTTCAAAAAGTTTAGGG - Intronic
988687322 5:33537828-33537850 AGCAACCTACAAATAGCTGGGGG + Intronic
990224742 5:53636849-53636871 AGGCATCTTCACGTGGCTGAAGG - Intronic
990616656 5:57515598-57515620 AACTACCTTCAAATATCTGAAGG - Intergenic
991492770 5:67199238-67199260 AGCTATTTTCAAATACTTGAAGG - Intergenic
995319766 5:110820487-110820509 AGCCATATTCATATGGCTGATGG + Intergenic
995453741 5:112330998-112331020 AGTCATCTTTAAATATGTGAAGG + Intronic
998097423 5:139404070-139404092 AGCCATTTCCAACTAGCTGGCGG - Intronic
999522192 5:152362239-152362261 TGCTAACTTCAAATACCTGAAGG + Intergenic
1000392587 5:160740543-160740565 AGAGTTCTTCAAATACCTGAAGG + Intronic
1000501820 5:162061432-162061454 AGACATTTTCAAATAAATGAAGG - Intergenic
1001793390 5:174480982-174481004 AGCCTTCTTGACATTGCTGATGG - Intergenic
1003005077 6:2373659-2373681 CTGCATCTTCACATAGCTGAAGG - Intergenic
1004230737 6:13830979-13831001 TACCATCTGCAAATAGATGATGG + Intergenic
1004583049 6:16972982-16973004 AACTGTCTTCAAATACCTGAGGG + Intergenic
1004691106 6:17992794-17992816 AGCCAGCCTCAAGTATCTGAGGG - Intergenic
1005609830 6:27513252-27513274 AGCCCTCTCCAAAGAGCTGTAGG - Intergenic
1006496059 6:34424626-34424648 AACTATCTTCAAATAGCTGAAGG + Intronic
1007855753 6:44854845-44854867 AGCTATCTTCAAATACCTGAAGG + Intronic
1008637913 6:53430674-53430696 AGGCATTTTCATATTGCTGATGG - Intergenic
1009633551 6:66233171-66233193 AGCAATTTTCAAATATGTGATGG + Intergenic
1010565168 6:77401880-77401902 GGGCATCATAAAATAGCTGAAGG + Intergenic
1010610592 6:77950349-77950371 ATACATCTTCACATGGCTGAAGG - Intergenic
1013339448 6:109199146-109199168 AGCCATGTGAAAACAGCTGAAGG + Intergenic
1014027189 6:116662521-116662543 AACAATCTTTAAATACCTGAAGG + Intronic
1014874917 6:126645902-126645924 TAACATCTTCAAAGAGCTGAGGG - Intergenic
1015020958 6:128474275-128474297 AGCTGTCATCAAATAGATGAAGG + Intronic
1015867065 6:137738240-137738262 AAACATTTTCAAATAGCTGAGGG + Intergenic
1016952890 6:149598419-149598441 AGCAATCAGAAAATAGCTGAGGG + Intronic
1018116830 6:160594550-160594572 CCCCATCTTCAAGAAGCTGAAGG - Intronic
1020058722 7:5136381-5136403 AGACCTCTTCACATAGCTTAGGG - Intergenic
1020452225 7:8333100-8333122 ACCCATCTTTCAAGAGCTGAAGG + Intergenic
1020921365 7:14269009-14269031 AGCCATCACCAAGAAGCTGAAGG + Intronic
1022844091 7:34192474-34192496 AAACATCTACAAATAGCAGAGGG + Intergenic
1024419343 7:49143898-49143920 ATACATTTTCAAATAGCTCAGGG - Intergenic
1030137567 7:106270791-106270813 AGGCATCTGCATTTAGCTGAGGG - Intronic
1030790218 7:113716622-113716644 AGCAGTCTTATAATAGCTGAAGG - Intergenic
1030916204 7:115316914-115316936 TACCATCTTTAATTAGCTGAAGG + Intergenic
1031100863 7:117478937-117478959 CGCCATCTTCAACTCTCTGAGGG - Intronic
1032955646 7:136969098-136969120 AGTCATCTTCAATTACTTGAGGG + Intronic
1034860344 7:154589737-154589759 AGCTGTCTGCAAATATCTGAAGG - Intronic
1035834131 8:2730011-2730033 AGGGATCTTCAAAAAGCTGTTGG - Intergenic
1038254426 8:25937879-25937901 CATAATCTTCAAATAGCTGAGGG + Intronic
1038640335 8:29319488-29319510 AGCCCTCTTGTAATTGCTGAAGG - Intergenic
1039130155 8:34254678-34254700 AGCCATATTCTCATAGCAGATGG - Intergenic
1040642617 8:49356860-49356882 AGCCACATTCAAAGAGGTGATGG + Intergenic
1041416214 8:57611304-57611326 TGCCATATTCAAAGAGCTGAGGG + Intergenic
1041704462 8:60831250-60831272 AGCAGTCTTCAGTTAGCTGAGGG + Intronic
1041904637 8:63018845-63018867 AGAAATCTTCAAAAAGCTCATGG + Intronic
1043721772 8:83553691-83553713 ATCCTTCTTCAAATAGCAGCAGG + Intergenic
1043854268 8:85246413-85246435 AGCCAACTGCAAATTGCTGTGGG - Exonic
1044067041 8:87711341-87711363 AGACATGTTAAAATAGTTGATGG + Intergenic
1045346476 8:101298257-101298279 GGCCATCTTCTAATGACTGAGGG + Intergenic
1046185175 8:110704587-110704609 AGCACTCTTCAAATATTTGAAGG + Intergenic
1047246438 8:123149196-123149218 AGTCATCTTCAAACATCTGAAGG - Intronic
1048062132 8:130931238-130931260 AGACATATTCAAAGTGCTGAAGG - Intronic
1050042018 9:1505859-1505881 AACAATCTTCAAATATTTGAAGG - Intergenic
1050299583 9:4243625-4243647 AGCCATTTTCAAATATGTGAAGG + Intronic
1051593187 9:18797056-18797078 ACCCCTCTTCAAAGAGCTGAAGG - Intronic
1052284228 9:26766672-26766694 AGTCATTTTCAAAGAGATGAAGG - Intergenic
1055244120 9:74219879-74219901 AGCCATGTTTAAAAATCTGATGG + Intergenic
1060094833 9:120779075-120779097 AGTCATCTTGAAATACGTGAAGG + Intronic
1060123101 9:121014422-121014444 AGCCATCTTCAAATATTTGAAGG - Intronic
1060696917 9:125717243-125717265 AGCCATCTTCAAATATCTAAAGG - Intergenic
1062204032 9:135325880-135325902 TACCATCCTCAAATCGCTGAAGG - Intergenic
1185664333 X:1752778-1752800 GGCCATCTTAAAAGAGCTGATGG + Intergenic
1188189237 X:27153980-27154002 TGCCATATTCAGATACCTGATGG - Intergenic
1189367579 X:40400862-40400884 GGTCATCTTCAAACATCTGAAGG - Intergenic
1191801755 X:65088727-65088749 AACCATCCTTAAATAACTGAAGG - Intergenic
1192508065 X:71702553-71702575 AGCCTTCTTGTAATTGCTGAAGG - Intergenic
1192518631 X:71779000-71779022 AGCCTTCTTGTAATTGCTGAAGG + Intergenic
1193233915 X:79083589-79083611 ACACATCTTCAAATATCTGAAGG - Intergenic
1194006282 X:88498095-88498117 AGCCATCTTGAGATAAATGAAGG - Intergenic
1194807071 X:98343248-98343270 AGGCTTCTACAAATAGCAGAAGG - Intergenic
1196042457 X:111219663-111219685 AGTCATCTCCATAAAGCTGATGG + Intronic
1196187939 X:112764479-112764501 AGTCGTCTTCAAATATTTGAAGG - Intergenic
1197951997 X:131908014-131908036 AGCCCTCTCCAAATAGCACAGGG - Intergenic
1198778449 X:140206919-140206941 AGCCATCTTCACCTTGATGATGG - Intergenic