ID: 1126167306

View in Genome Browser
Species Human (GRCh38)
Location 15:45664577-45664599
Sequence CAGAACAGCCCAGAATAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126167301_1126167306 14 Left 1126167301 15:45664540-45664562 CCCCATGAAAGAGGTGCCTGGAA 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1126167306 15:45664577-45664599 CAGAACAGCCCAGAATAGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 114
1126167305_1126167306 -2 Left 1126167305 15:45664556-45664578 CCTGGAAAGAAGGCAACTTTACA 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1126167306 15:45664577-45664599 CAGAACAGCCCAGAATAGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 114
1126167303_1126167306 12 Left 1126167303 15:45664542-45664564 CCATGAAAGAGGTGCCTGGAAAG 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1126167306 15:45664577-45664599 CAGAACAGCCCAGAATAGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 114
1126167302_1126167306 13 Left 1126167302 15:45664541-45664563 CCCATGAAAGAGGTGCCTGGAAA 0: 1
1: 0
2: 2
3: 21
4: 183
Right 1126167306 15:45664577-45664599 CAGAACAGCCCAGAATAGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126167306 Original CRISPR CAGAACAGCCCAGAATAGCG TGG Intronic
900850169 1:5136449-5136471 CAGAACAGCCCTGAAAGGTGGGG - Intergenic
902651056 1:17837944-17837966 CAGAGCAGCCCAGAGTCCCGTGG + Intergenic
908029204 1:59982030-59982052 CAGAACAACACAGAACAGCCAGG - Intergenic
912856965 1:113178006-113178028 CAGAACACCTCAGAAGAGTGAGG + Intergenic
913647519 1:120873068-120873090 CAGTAAATCCCAGAATAGGGTGG + Intergenic
914174024 1:145258339-145258361 CAGTAAATCCCAGAATAGGGTGG - Intergenic
914298929 1:146360972-146360994 CAGTAAATCCCAGAATAGGGTGG - Intergenic
914528685 1:148499524-148499546 CAGTAAATCCCAGAATAGGGTGG - Intergenic
914637708 1:149567584-149567606 CAGTAAATCCCAGAATAGGGTGG + Intergenic
916595009 1:166235159-166235181 CAGAACACCCAACAAAAGCGTGG - Intergenic
918340859 1:183567054-183567076 CAGAACAGCCCAGAGTCCTGGGG + Intronic
922354527 1:224763417-224763439 CTGAAAAGCCCAGAATAGAAGGG + Intergenic
922979416 1:229813052-229813074 CAGAAAAGCAAAGAATAGGGAGG - Intergenic
923091410 1:230743909-230743931 AAGAACAGCACAGAAAAGAGAGG + Intergenic
923334226 1:232952935-232952957 CAGAGCAGGCCAGAAGAGCCAGG + Intronic
1063203685 10:3810098-3810120 CAGCACAGCCCAGGAGAGCAAGG + Intergenic
1063285658 10:4684945-4684967 CAGAGCAGCCCTGAAGAGCAGGG + Intergenic
1069768192 10:70879350-70879372 CACACCAGCCCTGAATGGCGTGG - Exonic
1070552355 10:77500898-77500920 CAGTACAGCACAGACTAGTGTGG + Intronic
1072844318 10:98812533-98812555 CAGCACTGCCCAGAAAAGCAAGG + Intronic
1074473628 10:113749848-113749870 CAAAAAAGCCTAGAATAGGGTGG + Intergenic
1074536650 10:114332710-114332732 CAGAACAGAGCAGAAGAGTGAGG + Intronic
1075815317 10:125260505-125260527 GAGGACAGCACAGCATAGCGAGG + Intergenic
1080533372 11:33198245-33198267 CAGTACATCCCAAAATACCGTGG - Intergenic
1083229914 11:61310236-61310258 CAGAACAGCCTGGATTAGGGAGG + Intronic
1083772341 11:64875176-64875198 TAGAACAGCCCAGAAAGGCAAGG + Intronic
1083808128 11:65087203-65087225 CAGAACATCTCAGAATTGTGAGG - Intronic
1090097159 11:123753757-123753779 CAGAACAGCCCCGTAGAGCAGGG + Exonic
1090285853 11:125498012-125498034 CACAACAGGCCACAATAGAGTGG - Exonic
1094014922 12:25852078-25852100 CAGAACAGCCCTGGAGAGCAGGG - Intergenic
1096804462 12:54131987-54132009 CAGAACACCCCTGATTAGCCAGG + Intergenic
1102998480 12:117367314-117367336 CAGGTCAGCCCAGCTTAGCGGGG - Intronic
1105214191 13:18274741-18274763 CTGAACAGCCCAGAAAGGCAGGG + Intergenic
1108160445 13:47632904-47632926 CAGGAGAGCCCAGAAGAGAGGGG + Intergenic
1108778287 13:53794820-53794842 CAAAAAAGCCCGGAATAGCTGGG + Intergenic
1116215891 14:42017010-42017032 CAGAACAGGCCATAATATTGGGG - Intergenic
1118821649 14:69349781-69349803 CAGACAAGCCCAGAATTGAGTGG + Intronic
1122056179 14:99099675-99099697 CAGAACATCCCAGAACAGAGGGG + Intergenic
1122229288 14:100297556-100297578 CAGAGCAGCCCAGGACAGCCTGG - Intronic
1124891559 15:33738417-33738439 CAGAACAGGACAGACCAGCGGGG - Intronic
1126167306 15:45664577-45664599 CAGAACAGCCCAGAATAGCGTGG + Intronic
1126841119 15:52718311-52718333 CAGAACATTCCAGAATAGGTGGG + Intergenic
1127522768 15:59759501-59759523 CAGAACCGCCCAGTATTGTGGGG + Intergenic
1127789349 15:62385091-62385113 CAGAGCAGTCTAGAATAGCCTGG - Intergenic
1128399987 15:67268717-67268739 TGGAACAGCCCAGAATAGATAGG - Intronic
1128887389 15:71301607-71301629 AAGGACAGCCCAGAACAGCTAGG - Intronic
1132914861 16:2338502-2338524 CAAAACAGCCCAGAATCTCCAGG - Intronic
1134831599 16:17328109-17328131 CAGAACAGCCTAGAATAGTAGGG + Intronic
1135376647 16:21953073-21953095 CGGAAGAGCCCAAGATAGCGGGG + Exonic
1138549956 16:57742018-57742040 CAGGACAGCCCAGCATGGCTGGG + Intronic
1148028352 17:44603711-44603733 CACCACAGCCCAGAAGAGCAAGG - Intergenic
1151563115 17:74881365-74881387 CACAACAGCCCTGAAAAGCAGGG + Intronic
1155850106 18:30763711-30763733 CAGAACAGCCAAGCATAACTGGG + Intergenic
1164631287 19:29763090-29763112 CAGGCGAGCCCAGAATAGCTCGG - Intergenic
1166250886 19:41570145-41570167 CAGAACTGCACAGAATAATGGGG + Intronic
1167920747 19:52781366-52781388 CAGAACATCTCAGAATAACTTGG - Intronic
925073345 2:988347-988369 CAGAACAGGCCAGTATGGCCAGG - Intronic
934300128 2:91772009-91772031 CTGAACAGCCCAGAAAGGCAGGG - Intergenic
936653615 2:114458156-114458178 CAGAATAGCACAGGATAGCCTGG - Intronic
946126610 2:217568248-217568270 CAGAACATCCCAGAAGAGTTAGG - Intronic
948123217 2:235546150-235546172 CAGAACAGCCCAGATTGGTGTGG - Intronic
948643934 2:239392192-239392214 CAGCACAGCCCAGCGTAGCTCGG - Intronic
1171487740 20:25496387-25496409 GAGAAGAGCCCAGCAAAGCGAGG + Intronic
1175066069 20:56289914-56289936 CAGAACAGGCCAGACTTGCGTGG - Intergenic
1176024056 20:62976976-62976998 CAGTTCAGCCCAGCACAGCGAGG + Intergenic
1176293693 21:5059468-5059490 CAGAACAGGCCTGAAGAGAGGGG + Intergenic
1179863566 21:44204180-44204202 CAGAACAGGCCTGAAGAGAGGGG - Intergenic
1181079601 22:20405273-20405295 CAGATAAGCCCAGAAAAGAGAGG - Intronic
1181555895 22:23671514-23671536 CCGAACAGCCCAGAAAGGCAGGG + Intergenic
1181698482 22:24607139-24607161 CCGAACAGCCCAGAAAGGCAGGG - Intronic
1183643604 22:39108790-39108812 CAGAACATCCCAGCATAAAGGGG + Intergenic
1183685709 22:39360258-39360280 CAGAAGAGCCAAGAGTAGAGAGG - Intronic
1185076928 22:48688411-48688433 CAGATCAGCACTGAATAGCAAGG + Intronic
954572599 3:51654642-51654664 CAGAAAAGCCCAAAAAAGAGGGG - Intronic
955704572 3:61715007-61715029 CAGAAGCTCCCAGAATAGAGAGG + Intronic
963315927 3:143758722-143758744 CAGAAGAGCCAAGACTAGCAGGG + Intronic
966645173 3:182238288-182238310 CAGAAGGGCCCAGATTAGCTGGG - Intergenic
967369423 3:188727107-188727129 CAGAAAAGCCCAAAGTAGCTTGG + Intronic
968160515 3:196423135-196423157 CACAACAGCCCAACCTAGCGGGG + Intronic
972325963 4:38015562-38015584 CAGAAGAGCCCAGATCAGCATGG - Intronic
972391797 4:38620787-38620809 CAAAACAGCCCGGAAAAGCTTGG - Intergenic
972774709 4:42230288-42230310 TAGCACAGCCCAGGATAGGGAGG - Intergenic
980013421 4:127622360-127622382 CAGAACAGGCCAGAATGGTAAGG - Intergenic
982803692 4:159735996-159736018 CAGAATAGCCCAGACCAGTGCGG - Intergenic
985010895 4:185580963-185580985 CAGATCAGCCCAGAGCAGGGAGG - Intergenic
985588862 5:754696-754718 CAGCCCAGCCCAGGACAGCGTGG + Intronic
985603543 5:847212-847234 CAGCCCAGCCCAGGACAGCGTGG + Intronic
988404657 5:30808724-30808746 CAGAGCAGCCCATGATAGTGGGG + Intergenic
994739120 5:103595938-103595960 CAGCACAGCACAGAACAGAGGGG - Intergenic
997602369 5:135149481-135149503 CATAACAACCCAGAATGGAGGGG - Intronic
1003477259 6:6494957-6494979 CAAAACAGCCCAGAAGAAGGAGG - Intergenic
1004141116 6:13018561-13018583 CAGAGCAGCACAGTATAGCAGGG - Intronic
1005389964 6:25323037-25323059 CAAAACAACCAAGAATAGGGAGG - Intronic
1007168790 6:39847691-39847713 CTGAACCGCCAAGAATAGAGAGG - Intronic
1007258630 6:40546220-40546242 AGGAACAGCCCAGAGAAGCGGGG + Intronic
1009746316 6:67821234-67821256 CAGAATAGTCAAGAATAGTGAGG - Intergenic
1012315414 6:97779456-97779478 CAGAACAGCCCATAATAAAAAGG - Intergenic
1017029564 6:150208817-150208839 CAGAGCAGCCCGGCACAGCGTGG + Intronic
1018010676 6:159667129-159667151 GAGACCAGCCCAGAAAAGCACGG - Intergenic
1018099981 6:160428969-160428991 AGGACCAGCCCAGAATAGCCAGG - Intronic
1021291928 7:18856003-18856025 CAGCACAGACCACATTAGCGAGG + Intronic
1024313527 7:47991956-47991978 CAGAACCGCCCACAAGAGCATGG + Intronic
1028978461 7:96940274-96940296 CAGTACAGCCCAGAATTCCTGGG + Intergenic
1031770095 7:125831646-125831668 CAGAACATCCCAAAACAGCATGG - Intergenic
1033253610 7:139779999-139780021 CAAAACAGCCCGAGATAGCGTGG + Intronic
1040663812 8:49606347-49606369 CAACACAGCCCAGAAAAGAGAGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042714650 8:71759498-71759520 AAGAAAAGCCCAGAATTGGGAGG + Intergenic
1047779441 8:128099383-128099405 CAGAACACCCCAGAGGAGCCTGG + Intergenic
1050181126 9:2923898-2923920 CAGAACAGCACAGAGTTGGGGGG - Intergenic
1051070581 9:13161239-13161261 CAGAACATCCCAGAACACCACGG - Intronic
1051256376 9:15217912-15217934 AAAAACAGCCCAGTATAGCCAGG + Intronic
1054782558 9:69178571-69178593 CAGAATGGCCCAGAATAGCCAGG + Intronic
1056070307 9:82979355-82979377 CAGGACAGCCAGGAATAGTGAGG - Intergenic
1056841198 9:89999361-89999383 CAGAACAGCTCAGCACAGCCTGG - Intergenic
1062441107 9:136570240-136570262 CAGAGCAGCCCAGAACAGAGAGG + Intergenic
1185775207 X:2797507-2797529 CAGAACAGCCCAGCACAGACAGG - Intronic
1189770710 X:44423713-44423735 AAGAACAGCCCAGACACGCGTGG + Intergenic
1192073363 X:67964082-67964104 CCTAACAGGCCAGAATAGAGTGG + Intergenic
1199722610 X:150552906-150552928 CAGGACAGACTAGACTAGCGTGG + Intergenic
1201120628 Y:10870056-10870078 CAGAACAGAACAGAATGGCATGG - Intergenic