ID: 1126168051

View in Genome Browser
Species Human (GRCh38)
Location 15:45670452-45670474
Sequence GAGTGGCATTTCCATTGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126168051_1126168055 14 Left 1126168051 15:45670452-45670474 CCGATGCAATGGAAATGCCACTC 0: 1
1: 0
2: 2
3: 15
4: 128
Right 1126168055 15:45670489-45670511 TCCCCGTTTTCAGTGAGCTAGGG 0: 1
1: 0
2: 1
3: 8
4: 82
1126168051_1126168054 13 Left 1126168051 15:45670452-45670474 CCGATGCAATGGAAATGCCACTC 0: 1
1: 0
2: 2
3: 15
4: 128
Right 1126168054 15:45670488-45670510 ATCCCCGTTTTCAGTGAGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126168051 Original CRISPR GAGTGGCATTTCCATTGCAT CGG (reversed) Intronic
902529906 1:17084294-17084316 GAGCTGCATTTCCACTGCATAGG + Intronic
902938464 1:19782045-19782067 GAGTGGAATTGCCAGAGCATAGG - Intronic
905622297 1:39458724-39458746 CAGTGGCCTTTCCATTGTTTTGG + Intronic
906184576 1:43851719-43851741 GACTGGCATTGCTATTGCATGGG + Intronic
907720919 1:56971369-56971391 GAATGCCTTATCCATTGCATGGG + Intergenic
908599550 1:65724322-65724344 GAGTGGCATTGCTATGGCAAAGG + Intergenic
911157858 1:94654391-94654413 GAGTTGCAATTGCATTGAATAGG + Intergenic
913014187 1:114716406-114716428 AAGGGGGATTTCCATTGCTTAGG - Intronic
916733517 1:167587144-167587166 GAGGGACATTTCCAGGGCATGGG - Intergenic
918435309 1:184504972-184504994 CAGTAGCTTTTCCATTTCATTGG + Intronic
919163760 1:193866019-193866041 GAGTGTCATTTTCAAGGCATTGG + Intergenic
921731942 1:218588402-218588424 GTGTGGTCTTTCCATTCCATGGG + Intergenic
921836331 1:219782517-219782539 GTGTGACATTTACATAGCATGGG - Intronic
1064350606 10:14572995-14573017 GAGTGGAATTACCATTGCAGAGG + Intronic
1069726354 10:70582794-70582816 GGGTGGCATTTCCATTGAGGTGG + Intergenic
1070872655 10:79770682-79770704 GTGTGGCATTTCAGTTGAATAGG + Intergenic
1071639577 10:87292831-87292853 GTGTGGCATTTCAGTTGAATAGG + Intergenic
1071655658 10:87445121-87445143 GTGTGGCATTTCAGTTGAATAGG - Intergenic
1072413329 10:95226114-95226136 GAGTGCCATTTCCATTGTAAAGG + Intronic
1073978428 10:109126556-109126578 TACTGCTATTTCCATTGCATAGG + Intergenic
1076651784 10:131994624-131994646 GAGTGGCATTTCCATTTCAGTGG + Intergenic
1078656142 11:13241776-13241798 TAGTGCTATTTCCATTTCATAGG - Intergenic
1079052243 11:17172241-17172263 CAGTGTCACTTCCATTTCATTGG - Intronic
1081693839 11:45095648-45095670 GGGTTGCAGTTCTATTGCATTGG - Intergenic
1082629964 11:55530279-55530301 GACTGGCACTGCCATTGCCTGGG + Intergenic
1082761209 11:57128665-57128687 GAGTCACATGTCCATTGGATGGG + Intergenic
1082958185 11:58894051-58894073 AAGTGTCATTTCCATAGCAGAGG - Intronic
1084070890 11:66733720-66733742 GAGTGGAAGTTCTGTTGCATTGG - Intergenic
1086867723 11:92000381-92000403 GATTAACATTTCCATTGTATAGG - Intergenic
1087850650 11:103024348-103024370 CACTGGCATTCTCATTGCATTGG - Intergenic
1092201163 12:6584169-6584191 ATGTAGCATTTACATTGCATTGG + Intronic
1093147926 12:15588887-15588909 GAGAGACATTTGCACTGCATTGG - Intronic
1095329215 12:40937415-40937437 GAGTGGGATTTTCATGGCATGGG - Intronic
1099043644 12:77687753-77687775 GAGAGGCATTGCCATTTCTTTGG - Intergenic
1101192498 12:102349514-102349536 CAGTAGCATTTGCATTGCTTGGG - Intergenic
1106398153 13:29401614-29401636 GGGTGGCATTTCAAATCCATGGG - Intronic
1108017251 13:46088523-46088545 AAGTGGAATTGCCATTTCATGGG + Intronic
1110011476 13:70339851-70339873 GTGTGACATTTCCATAGGATGGG - Intergenic
1110941592 13:81357281-81357303 GAGTGGCATTTCAATTTGAAAGG - Intergenic
1111063748 13:83062269-83062291 GACTGGCATTTCCACAGCACTGG - Intergenic
1115343064 14:32312676-32312698 AAGAGGAAATTCCATTGCATAGG + Intergenic
1120484792 14:85099456-85099478 AAGTGGTATATCCATTCCATAGG - Intergenic
1120487717 14:85135635-85135657 GATAGGCATTTCTATTCCATTGG - Intergenic
1202873936 14_GL000225v1_random:190990-191012 TCGTGGCCTTTCCATTCCATTGG - Intergenic
1202874405 14_GL000225v1_random:194476-194498 TCGTGGCCTTTCCATTCCATTGG - Intergenic
1124181855 15:27483559-27483581 GAGTGGCATTTCAGTTGCACTGG + Intronic
1126168051 15:45670452-45670474 GAGTGGCATTTCCATTGCATCGG - Intronic
1126873579 15:53014120-53014142 AAGTGGAATTACCATTGCATGGG - Intergenic
1128636132 15:69303679-69303701 GAGTGGCATTCCCATGGACTTGG + Intronic
1132511938 16:347339-347361 GAGTGGCATTCCCATGTCCTGGG - Intronic
1133591225 16:7246264-7246286 GAGAGGCAATTGGATTGCATTGG - Intronic
1137888501 16:52132503-52132525 GTGTGGCAATTCCATTGTAGGGG - Intergenic
1138731393 16:59198875-59198897 TAGTGTCATTTCCACTTCATGGG + Intergenic
1143046164 17:4081584-4081606 CAGTGTCATTTCCATGGGATGGG + Intronic
1143252412 17:5533202-5533224 GAGTGGCACTTCTATTCCAGTGG - Intronic
1149981166 17:61312578-61312600 GAGTGGGATTTTCCTTGCATTGG - Intronic
1153215722 18:2819219-2819241 GACTCTCAATTCCATTGCATTGG - Intergenic
1155047455 18:22115240-22115262 GAGTGGCATTTTCGCTGCATGGG + Intergenic
1156276700 18:35590566-35590588 GAGTAGAATTTGCATTGCATTGG + Intronic
1158831003 18:61278428-61278450 CAGTGCCATTTCCATTACATTGG + Intergenic
1159475754 18:68918754-68918776 GAATTCCATTTACATTGCATTGG + Intronic
1164541056 19:29121905-29121927 CAGTGACATTTCCATTCCCTGGG + Intergenic
1167058040 19:47125234-47125256 GAGAGGCATTTCCATTTTGTTGG + Intronic
925923203 2:8651956-8651978 GAGTGGCAGTTACAGTGCAGGGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
934861852 2:97770555-97770577 GAGTGTCATTACCTTTGCAAGGG - Intronic
936504033 2:113090466-113090488 GAGTGGCATTTCCAATGCAGTGG - Intergenic
943487170 2:188500620-188500642 GAGAGGCATTTCTATTTCATTGG - Intronic
944359710 2:198839087-198839109 GAGTGGGATTTTCTTTGCCTTGG - Intergenic
946633139 2:221693593-221693615 GAGTGGCAGCTCCATTGCTGTGG + Intergenic
1169100374 20:2942636-2942658 GAGTTGCATTTCAAGTGCAAAGG - Intronic
1169986980 20:11456214-11456236 GAGTTGCAGTTACATTGCAAAGG - Intergenic
1174279585 20:49429449-49429471 GAGGAGCATTTCCATGGCAAGGG + Intronic
1177894051 21:26840560-26840582 GGTTGGCATTTCCTTTGCAGGGG - Exonic
1179032574 21:37733398-37733420 GATGGGCATTTCCTTTGCCTGGG + Intronic
1179712278 21:43270147-43270169 CACTGGCACTTCCATTTCATGGG - Intergenic
1180283769 22:10725639-10725661 TCGTGGCCTTTCCATTCCATTGG + Intergenic
1180531415 22:16352989-16353011 TCGTGGCCTTTCCATTCCATTGG - Intergenic
1182486338 22:30641261-30641283 GAGTGGCATGTGCCTGGCATCGG + Intronic
1182911707 22:33989896-33989918 GTGTGGCCTTTCCATTGTTTTGG + Intergenic
1203318225 22_KI270737v1_random:32788-32810 TCGTGGCCTTTCCATTCCATTGG + Intergenic
949728984 3:7085096-7085118 GAGTGGCATTTTAATGGCAGTGG + Intronic
951402727 3:22253856-22253878 GAGAGGCATTTCAAATCCATGGG + Intronic
952204122 3:31162654-31162676 CAGTGGAATTTCCTTTGCAGAGG + Intergenic
952898400 3:38094372-38094394 CAGTGGCAACTCCATAGCATAGG - Intronic
960774594 3:121235176-121235198 ATGTGGCATTCCCATTTCATTGG + Intronic
960881483 3:122349821-122349843 GAGTGTCATTCTCTTTGCATAGG - Intergenic
961672901 3:128547813-128547835 GAGGGGCAGTTCCATTCCAACGG + Intergenic
962648382 3:137463183-137463205 GAGTTGCCTTTCCATAACATAGG - Intergenic
962893653 3:139694915-139694937 CAATGGAATTTCCATTGCTTGGG - Intergenic
965935694 3:174107927-174107949 AAGAGCCATTTCCATTGAATAGG - Intronic
967693867 3:192508282-192508304 GTGGGGCATTTGCATTTCATAGG - Intronic
969261922 4:6039056-6039078 CAGTGGGATTTCAGTTGCATGGG - Intronic
971336286 4:25726847-25726869 GGGTGGCTTTTCCATGGCAATGG + Intergenic
971599132 4:28569843-28569865 GAGTGGCATTTACATCAAATGGG - Intergenic
974206689 4:58712840-58712862 GAGTGGCATCTACATTTCAAGGG + Intergenic
977748560 4:100580562-100580584 GAGAGGCATTGCCATTCCAAAGG - Intronic
980762008 4:137246977-137246999 CAGTGCCAGTTGCATTGCATAGG + Intergenic
982672468 4:158337753-158337775 GAATGGAATTTCCATTTCCTAGG + Intronic
984909485 4:184659473-184659495 GAGTTCCATTTCCTTTGCCTAGG + Intronic
987844165 5:23259936-23259958 GATTAGAATTGCCATTGCATAGG + Intergenic
988215814 5:28270797-28270819 GAGAGGCATATCCATTAGATAGG + Intergenic
988790988 5:34607428-34607450 ACATGGCATTTGCATTGCATTGG + Intergenic
989242649 5:39218423-39218445 CGGTGGCATTCCCATAGCATGGG + Intronic
997667311 5:135642067-135642089 GTTTGGCATATCCATAGCATTGG - Intergenic
998755034 5:145368484-145368506 GTTTGGCATTTCCAAGGCATTGG - Intergenic
1004157230 6:13180859-13180881 CTGTGTGATTTCCATTGCATGGG + Intronic
1004480830 6:16017965-16017987 GAGTGGCCTATCCACAGCATAGG - Intergenic
1004893195 6:20121628-20121650 GAAAGGCCATTCCATTGCATAGG - Intronic
1006443113 6:34064257-34064279 GAATAGCATTTCCCATGCATTGG - Intronic
1014484995 6:121987472-121987494 GAGTGGAATTGTCATTTCATAGG + Intergenic
1015811359 6:137164737-137164759 GAGTGGCATCTGCATTGCTTGGG - Intronic
1016284588 6:142459021-142459043 GAGTTGCATTTCAATTCCAAAGG + Intergenic
1016666261 6:146644515-146644537 GAGTAGCATTTTGATTGTATAGG - Intronic
1018615708 6:165684520-165684542 GAGTTGCATTGGCATTTCATTGG + Intronic
1024947174 7:54820235-54820257 TGGTGGCATGTCCATTGCCTAGG - Intergenic
1026592139 7:71706220-71706242 GAGTGGGATTTCCTTTCCAGGGG - Intronic
1028489738 7:91397801-91397823 TAGTGACATTTCCCTTGCATGGG - Intergenic
1029351614 7:100016711-100016733 GAGTGGCTGTTCCATGGCCTGGG + Intronic
1030321565 7:108173995-108174017 CAGTGACATGTCCACTGCATAGG + Intronic
1031300925 7:120060143-120060165 GAGAGGCATTTGCATAGCCTGGG + Intergenic
1047559829 8:125974434-125974456 GAGTTTCTTTTCCTTTGCATTGG + Intergenic
1048711375 8:137215387-137215409 GACTTGAATTTCTATTGCATTGG - Intergenic
1050364353 9:4860459-4860481 CAGTGGCATTGCCATTGCCCAGG + Exonic
1051691868 9:19722720-19722742 CACTGGAATTTCCGTTGCATAGG - Intronic
1056102554 9:83313647-83313669 GAGGGGCAGTTACCTTGCATGGG + Exonic
1059471274 9:114506053-114506075 AAGTGGCTTTTCCCTTGCAATGG - Intergenic
1059824319 9:118010025-118010047 GCTTTGCATTTCTATTGCATTGG + Intergenic
1203730024 Un_GL000216v2:81888-81910 TCGTGGCCTTTCCATTCCATTGG + Intergenic
1203730520 Un_GL000216v2:85503-85525 TCGTGGCCTTTCCATTCCATTGG + Intergenic
1186301992 X:8210009-8210031 GAATGTCATTTCTACTGCATTGG - Intergenic
1186588159 X:10898750-10898772 CAGTGGCATTTCCATTCAATGGG - Intergenic
1186666277 X:11720622-11720644 GAGTGGAGTTTCCATAGCTTGGG - Intergenic
1188182806 X:27076149-27076171 TATCGGCTTTTCCATTGCATTGG - Intergenic
1189084384 X:38005207-38005229 TATTGGCATTTCCATAGAATTGG - Intronic
1189580803 X:42404277-42404299 GTATGGCGTTTCCATAGCATGGG + Intergenic
1190476031 X:50828258-50828280 GAGTAGCTTTTCCTTTGCTTAGG + Intergenic
1194534816 X:95093455-95093477 GAGTGGCAAGTCCATTCAATGGG + Intergenic
1197052903 X:122081671-122081693 GGGAGGCATTTCAATTGCAAAGG - Intergenic
1197357714 X:125457021-125457043 GAATGACATTTACATTACATTGG - Intergenic
1199513026 X:148644008-148644030 AAGTGGCATTTCCATTAAAATGG + Intronic
1200937148 Y:8748282-8748304 GAGTGGCTTTTTTTTTGCATGGG + Intergenic
1200959887 Y:8986943-8986965 GTGTGGCCTTTTCATTGCTTGGG - Intergenic
1201433531 Y:13930997-13931019 CAGTAGCATTTCCATTTCCTCGG + Intergenic
1202180655 Y:22137026-22137048 GAGTGGCTTTTCTTTTGCAGGGG + Intergenic
1202210705 Y:22449373-22449395 GAGTGGCTTTTCTTTTGCAGGGG - Intergenic