ID: 1126172263

View in Genome Browser
Species Human (GRCh38)
Location 15:45704806-45704828
Sequence CTCGGTCCCCTCCACTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126172260_1126172263 17 Left 1126172260 15:45704766-45704788 CCTTAAAGTCCAGCTCACGCTGC No data
Right 1126172263 15:45704806-45704828 CTCGGTCCCCTCCACTGCACTGG No data
1126172261_1126172263 8 Left 1126172261 15:45704775-45704797 CCAGCTCACGCTGCTGTGCTGCA No data
Right 1126172263 15:45704806-45704828 CTCGGTCCCCTCCACTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126172263 Original CRISPR CTCGGTCCCCTCCACTGCAC TGG Intergenic
No off target data available for this crispr