ID: 1126172925

View in Genome Browser
Species Human (GRCh38)
Location 15:45709077-45709099
Sequence GATTCCAGCTGAGGGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126172925_1126172932 24 Left 1126172925 15:45709077-45709099 CCTTTGTCCCCTCAGCTGGAATC No data
Right 1126172932 15:45709124-45709146 TAGAGCCCCCAGAGACATCCAGG No data
1126172925_1126172933 25 Left 1126172925 15:45709077-45709099 CCTTTGTCCCCTCAGCTGGAATC No data
Right 1126172933 15:45709125-45709147 AGAGCCCCCAGAGACATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126172925 Original CRISPR GATTCCAGCTGAGGGGACAA AGG (reversed) Intergenic
No off target data available for this crispr