ID: 1126172928

View in Genome Browser
Species Human (GRCh38)
Location 15:45709086-45709108
Sequence CCACAAGCTGATTCCAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126172928_1126172933 16 Left 1126172928 15:45709086-45709108 CCTCAGCTGGAATCAGCTTGTGG No data
Right 1126172933 15:45709125-45709147 AGAGCCCCCAGAGACATCCAGGG No data
1126172928_1126172938 30 Left 1126172928 15:45709086-45709108 CCTCAGCTGGAATCAGCTTGTGG No data
Right 1126172938 15:45709139-45709161 CATCCAGGGACTCTGAATGCAGG No data
1126172928_1126172932 15 Left 1126172928 15:45709086-45709108 CCTCAGCTGGAATCAGCTTGTGG No data
Right 1126172932 15:45709124-45709146 TAGAGCCCCCAGAGACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126172928 Original CRISPR CCACAAGCTGATTCCAGCTG AGG (reversed) Intergenic
No off target data available for this crispr