ID: 1126172933

View in Genome Browser
Species Human (GRCh38)
Location 15:45709125-45709147
Sequence AGAGCCCCCAGAGACATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126172926_1126172933 18 Left 1126172926 15:45709084-45709106 CCCCTCAGCTGGAATCAGCTTGT No data
Right 1126172933 15:45709125-45709147 AGAGCCCCCAGAGACATCCAGGG No data
1126172925_1126172933 25 Left 1126172925 15:45709077-45709099 CCTTTGTCCCCTCAGCTGGAATC No data
Right 1126172933 15:45709125-45709147 AGAGCCCCCAGAGACATCCAGGG No data
1126172928_1126172933 16 Left 1126172928 15:45709086-45709108 CCTCAGCTGGAATCAGCTTGTGG No data
Right 1126172933 15:45709125-45709147 AGAGCCCCCAGAGACATCCAGGG No data
1126172927_1126172933 17 Left 1126172927 15:45709085-45709107 CCCTCAGCTGGAATCAGCTTGTG No data
Right 1126172933 15:45709125-45709147 AGAGCCCCCAGAGACATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126172933 Original CRISPR AGAGCCCCCAGAGACATCCA GGG Intergenic
No off target data available for this crispr