ID: 1126174962

View in Genome Browser
Species Human (GRCh38)
Location 15:45727709-45727731
Sequence AGGATTGAATAGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126174960_1126174962 -4 Left 1126174960 15:45727690-45727712 CCAGGGATAGGGGAGAGGGAGGA No data
Right 1126174962 15:45727709-45727731 AGGATTGAATAGATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126174962 Original CRISPR AGGATTGAATAGATGGAGCA TGG Intergenic
No off target data available for this crispr