ID: 1126176308

View in Genome Browser
Species Human (GRCh38)
Location 15:45739013-45739035
Sequence GTGAAAAATACGGCAAATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126176305_1126176308 1 Left 1126176305 15:45738989-45739011 CCAACAAATGTAGATTGTCTGGT No data
Right 1126176308 15:45739013-45739035 GTGAAAAATACGGCAAATTATGG No data
1126176303_1126176308 2 Left 1126176303 15:45738988-45739010 CCCAACAAATGTAGATTGTCTGG No data
Right 1126176308 15:45739013-45739035 GTGAAAAATACGGCAAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126176308 Original CRISPR GTGAAAAATACGGCAAATTA TGG Intergenic
No off target data available for this crispr