ID: 1126178836

View in Genome Browser
Species Human (GRCh38)
Location 15:45765276-45765298
Sequence CCTTATATTCAAAGGCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126178836_1126178844 16 Left 1126178836 15:45765276-45765298 CCTACTTGCCTTTGAATATAAGG No data
Right 1126178844 15:45765315-45765337 GAAGTACCTTATAGTTCAATGGG No data
1126178836_1126178845 17 Left 1126178836 15:45765276-45765298 CCTACTTGCCTTTGAATATAAGG No data
Right 1126178845 15:45765316-45765338 AAGTACCTTATAGTTCAATGGGG No data
1126178836_1126178843 15 Left 1126178836 15:45765276-45765298 CCTACTTGCCTTTGAATATAAGG No data
Right 1126178843 15:45765314-45765336 GGAAGTACCTTATAGTTCAATGG No data
1126178836_1126178839 -6 Left 1126178836 15:45765276-45765298 CCTACTTGCCTTTGAATATAAGG No data
Right 1126178839 15:45765293-45765315 ATAAGGAGCCCAGAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126178836 Original CRISPR CCTTATATTCAAAGGCAAGT AGG (reversed) Intergenic
No off target data available for this crispr