ID: 1126181217

View in Genome Browser
Species Human (GRCh38)
Location 15:45787069-45787091
Sequence TTTAATAAGCAACAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126181217_1126181224 0 Left 1126181217 15:45787069-45787091 CCCTCCTCTTGTTGCTTATTAAA No data
Right 1126181224 15:45787092-45787114 TTTTTTTTCTGGGCTGGGTGCGG No data
1126181217_1126181223 -5 Left 1126181217 15:45787069-45787091 CCCTCCTCTTGTTGCTTATTAAA No data
Right 1126181223 15:45787087-45787109 TTAAATTTTTTTTCTGGGCTGGG No data
1126181217_1126181221 -10 Left 1126181217 15:45787069-45787091 CCCTCCTCTTGTTGCTTATTAAA No data
Right 1126181221 15:45787082-45787104 GCTTATTAAATTTTTTTTCTGGG No data
1126181217_1126181222 -6 Left 1126181217 15:45787069-45787091 CCCTCCTCTTGTTGCTTATTAAA No data
Right 1126181222 15:45787086-45787108 ATTAAATTTTTTTTCTGGGCTGG No data
1126181217_1126181226 30 Left 1126181217 15:45787069-45787091 CCCTCCTCTTGTTGCTTATTAAA No data
Right 1126181226 15:45787122-45787144 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
1126181217_1126181225 3 Left 1126181217 15:45787069-45787091 CCCTCCTCTTGTTGCTTATTAAA No data
Right 1126181225 15:45787095-45787117 TTTTTCTGGGCTGGGTGCGGTGG 0: 2
1: 17
2: 217
3: 1399
4: 6000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126181217 Original CRISPR TTTAATAAGCAACAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr