ID: 1126181583

View in Genome Browser
Species Human (GRCh38)
Location 15:45790760-45790782
Sequence CAGACTGAACAAGGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126181583_1126181587 8 Left 1126181583 15:45790760-45790782 CCATCTGCCCCTTGTTCAGTCTG No data
Right 1126181587 15:45790791-45790813 TCTGACCCTTTCTTACTGTTAGG No data
1126181583_1126181588 9 Left 1126181583 15:45790760-45790782 CCATCTGCCCCTTGTTCAGTCTG No data
Right 1126181588 15:45790792-45790814 CTGACCCTTTCTTACTGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126181583 Original CRISPR CAGACTGAACAAGGGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr