ID: 1126187048

View in Genome Browser
Species Human (GRCh38)
Location 15:45840935-45840957
Sequence CTCTGGGCTTGTAAATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126187048_1126187058 26 Left 1126187048 15:45840935-45840957 CCTTCTTATTTACAAGCCCAGAG No data
Right 1126187058 15:45840984-45841006 TTCTTTGTGATATGGACAGGAGG No data
1126187048_1126187056 18 Left 1126187048 15:45840935-45840957 CCTTCTTATTTACAAGCCCAGAG No data
Right 1126187056 15:45840976-45840998 TTCAGGATTTCTTTGTGATATGG No data
1126187048_1126187059 29 Left 1126187048 15:45840935-45840957 CCTTCTTATTTACAAGCCCAGAG No data
Right 1126187059 15:45840987-45841009 TTTGTGATATGGACAGGAGGTGG No data
1126187048_1126187052 1 Left 1126187048 15:45840935-45840957 CCTTCTTATTTACAAGCCCAGAG No data
Right 1126187052 15:45840959-45840981 CTCTCTGAACCCCATACTTCAGG No data
1126187048_1126187060 30 Left 1126187048 15:45840935-45840957 CCTTCTTATTTACAAGCCCAGAG No data
Right 1126187060 15:45840988-45841010 TTGTGATATGGACAGGAGGTGGG No data
1126187048_1126187057 23 Left 1126187048 15:45840935-45840957 CCTTCTTATTTACAAGCCCAGAG No data
Right 1126187057 15:45840981-45841003 GATTTCTTTGTGATATGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126187048 Original CRISPR CTCTGGGCTTGTAAATAAGA AGG (reversed) Intergenic
No off target data available for this crispr