ID: 1126189887

View in Genome Browser
Species Human (GRCh38)
Location 15:45868281-45868303
Sequence ACCAGGACCTTATACATCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126189887_1126189889 1 Left 1126189887 15:45868281-45868303 CCTATGATGTATAAGGTCCTGGT No data
Right 1126189889 15:45868305-45868327 AATCACCAACTCATAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126189887 Original CRISPR ACCAGGACCTTATACATCAT AGG (reversed) Intergenic
No off target data available for this crispr