ID: 1126189929

View in Genome Browser
Species Human (GRCh38)
Location 15:45868683-45868705
Sequence CACTTGGAATGGTGGTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126189929_1126189938 20 Left 1126189929 15:45868683-45868705 CCCATTTACCACCATTCCAAGTG No data
Right 1126189938 15:45868726-45868748 CTTCTTGTCCCTGAAACTCCAGG No data
1126189929_1126189936 -10 Left 1126189929 15:45868683-45868705 CCCATTTACCACCATTCCAAGTG No data
Right 1126189936 15:45868696-45868718 ATTCCAAGTGACACATGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126189929 Original CRISPR CACTTGGAATGGTGGTAAAT GGG (reversed) Intergenic
No off target data available for this crispr