ID: 1126189955

View in Genome Browser
Species Human (GRCh38)
Location 15:45868861-45868883
Sequence CCTCATATTCAGGGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126189948_1126189955 22 Left 1126189948 15:45868816-45868838 CCCATTCAACTGTAAGCTATGGC No data
Right 1126189955 15:45868861-45868883 CCTCATATTCAGGGAGAAGCAGG No data
1126189949_1126189955 21 Left 1126189949 15:45868817-45868839 CCATTCAACTGTAAGCTATGGCT No data
Right 1126189955 15:45868861-45868883 CCTCATATTCAGGGAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126189955 Original CRISPR CCTCATATTCAGGGAGAAGC AGG Intergenic
No off target data available for this crispr