ID: 1126190244

View in Genome Browser
Species Human (GRCh38)
Location 15:45871402-45871424
Sequence CCCAGGGAACAGAACTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126190239_1126190244 8 Left 1126190239 15:45871371-45871393 CCTGTGTGTTGCAGCAGAGGCAG No data
Right 1126190244 15:45871402-45871424 CCCAGGGAACAGAACTCCATTGG No data
1126190237_1126190244 16 Left 1126190237 15:45871363-45871385 CCTGGTGACCTGTGTGTTGCAGC No data
Right 1126190244 15:45871402-45871424 CCCAGGGAACAGAACTCCATTGG No data
1126190234_1126190244 24 Left 1126190234 15:45871355-45871377 CCCACTTCCCTGGTGACCTGTGT 0: 17
1: 70
2: 134
3: 195
4: 375
Right 1126190244 15:45871402-45871424 CCCAGGGAACAGAACTCCATTGG No data
1126190235_1126190244 23 Left 1126190235 15:45871356-45871378 CCACTTCCCTGGTGACCTGTGTG 0: 14
1: 59
2: 120
3: 195
4: 445
Right 1126190244 15:45871402-45871424 CCCAGGGAACAGAACTCCATTGG No data
1126190236_1126190244 17 Left 1126190236 15:45871362-45871384 CCCTGGTGACCTGTGTGTTGCAG No data
Right 1126190244 15:45871402-45871424 CCCAGGGAACAGAACTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126190244 Original CRISPR CCCAGGGAACAGAACTCCAT TGG Intergenic
No off target data available for this crispr