ID: 1126192796

View in Genome Browser
Species Human (GRCh38)
Location 15:45896280-45896302
Sequence CAGAGGTACAAGAGGGAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126192796_1126192804 25 Left 1126192796 15:45896280-45896302 CCGCTTTCCCTCTTGTACCTCTG No data
Right 1126192804 15:45896328-45896350 TTGCTGGAGAATGAGAGACATGG No data
1126192796_1126192802 9 Left 1126192796 15:45896280-45896302 CCGCTTTCCCTCTTGTACCTCTG No data
Right 1126192802 15:45896312-45896334 AGAGTATATGCCAGGCTTGCTGG No data
1126192796_1126192801 1 Left 1126192796 15:45896280-45896302 CCGCTTTCCCTCTTGTACCTCTG No data
Right 1126192801 15:45896304-45896326 CATCATTGAGAGTATATGCCAGG No data
1126192796_1126192805 26 Left 1126192796 15:45896280-45896302 CCGCTTTCCCTCTTGTACCTCTG No data
Right 1126192805 15:45896329-45896351 TGCTGGAGAATGAGAGACATGGG No data
1126192796_1126192806 30 Left 1126192796 15:45896280-45896302 CCGCTTTCCCTCTTGTACCTCTG No data
Right 1126192806 15:45896333-45896355 GGAGAATGAGAGACATGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126192796 Original CRISPR CAGAGGTACAAGAGGGAAAG CGG (reversed) Intergenic
No off target data available for this crispr