ID: 1126192802

View in Genome Browser
Species Human (GRCh38)
Location 15:45896312-45896334
Sequence AGAGTATATGCCAGGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126192795_1126192802 21 Left 1126192795 15:45896268-45896290 CCTTTCATATTTCCGCTTTCCCT No data
Right 1126192802 15:45896312-45896334 AGAGTATATGCCAGGCTTGCTGG No data
1126192797_1126192802 2 Left 1126192797 15:45896287-45896309 CCCTCTTGTACCTCTGCCATCAT No data
Right 1126192802 15:45896312-45896334 AGAGTATATGCCAGGCTTGCTGG No data
1126192799_1126192802 -8 Left 1126192799 15:45896297-45896319 CCTCTGCCATCATTGAGAGTATA No data
Right 1126192802 15:45896312-45896334 AGAGTATATGCCAGGCTTGCTGG No data
1126192796_1126192802 9 Left 1126192796 15:45896280-45896302 CCGCTTTCCCTCTTGTACCTCTG No data
Right 1126192802 15:45896312-45896334 AGAGTATATGCCAGGCTTGCTGG No data
1126192798_1126192802 1 Left 1126192798 15:45896288-45896310 CCTCTTGTACCTCTGCCATCATT No data
Right 1126192802 15:45896312-45896334 AGAGTATATGCCAGGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126192802 Original CRISPR AGAGTATATGCCAGGCTTGC TGG Intergenic
No off target data available for this crispr