ID: 1126192806

View in Genome Browser
Species Human (GRCh38)
Location 15:45896333-45896355
Sequence GGAGAATGAGAGACATGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126192800_1126192806 7 Left 1126192800 15:45896303-45896325 CCATCATTGAGAGTATATGCCAG No data
Right 1126192806 15:45896333-45896355 GGAGAATGAGAGACATGGGAAGG No data
1126192797_1126192806 23 Left 1126192797 15:45896287-45896309 CCCTCTTGTACCTCTGCCATCAT No data
Right 1126192806 15:45896333-45896355 GGAGAATGAGAGACATGGGAAGG No data
1126192796_1126192806 30 Left 1126192796 15:45896280-45896302 CCGCTTTCCCTCTTGTACCTCTG No data
Right 1126192806 15:45896333-45896355 GGAGAATGAGAGACATGGGAAGG No data
1126192799_1126192806 13 Left 1126192799 15:45896297-45896319 CCTCTGCCATCATTGAGAGTATA No data
Right 1126192806 15:45896333-45896355 GGAGAATGAGAGACATGGGAAGG No data
1126192798_1126192806 22 Left 1126192798 15:45896288-45896310 CCTCTTGTACCTCTGCCATCATT No data
Right 1126192806 15:45896333-45896355 GGAGAATGAGAGACATGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126192806 Original CRISPR GGAGAATGAGAGACATGGGA AGG Intergenic
No off target data available for this crispr