ID: 1126196484

View in Genome Browser
Species Human (GRCh38)
Location 15:45937296-45937318
Sequence TGGGGCAGTAAAGCAGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126196484_1126196491 30 Left 1126196484 15:45937296-45937318 CCTCCAACTGCTTTACTGCCCCA No data
Right 1126196491 15:45937349-45937371 TCTACGAGCTGCTACAGTGATGG No data
1126196484_1126196487 -9 Left 1126196484 15:45937296-45937318 CCTCCAACTGCTTTACTGCCCCA No data
Right 1126196487 15:45937310-45937332 ACTGCCCCAGGTGTCAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126196484 Original CRISPR TGGGGCAGTAAAGCAGTTGG AGG (reversed) Intergenic
No off target data available for this crispr