ID: 1126200133

View in Genome Browser
Species Human (GRCh38)
Location 15:45976072-45976094
Sequence TAGCCAACCCCACTTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126200129_1126200133 20 Left 1126200129 15:45976029-45976051 CCAAAGGCAATGCTTGTATATGG No data
Right 1126200133 15:45976072-45976094 TAGCCAACCCCACTTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126200133 Original CRISPR TAGCCAACCCCACTTGTGGC TGG Intergenic
No off target data available for this crispr