ID: 1126200143

View in Genome Browser
Species Human (GRCh38)
Location 15:45976111-45976133
Sequence ATCCTGAAGGGGGATTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126200137_1126200143 8 Left 1126200137 15:45976080-45976102 CCCACTTGTGGCTGGGAGAATGA No data
Right 1126200143 15:45976111-45976133 ATCCTGAAGGGGGATTTGAGTGG No data
1126200135_1126200143 13 Left 1126200135 15:45976075-45976097 CCAACCCCACTTGTGGCTGGGAG No data
Right 1126200143 15:45976111-45976133 ATCCTGAAGGGGGATTTGAGTGG No data
1126200131_1126200143 23 Left 1126200131 15:45976065-45976087 CCATTAGTAGCCAACCCCACTTG No data
Right 1126200143 15:45976111-45976133 ATCCTGAAGGGGGATTTGAGTGG No data
1126200138_1126200143 7 Left 1126200138 15:45976081-45976103 CCACTTGTGGCTGGGAGAATGAG No data
Right 1126200143 15:45976111-45976133 ATCCTGAAGGGGGATTTGAGTGG No data
1126200136_1126200143 9 Left 1126200136 15:45976079-45976101 CCCCACTTGTGGCTGGGAGAATG No data
Right 1126200143 15:45976111-45976133 ATCCTGAAGGGGGATTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126200143 Original CRISPR ATCCTGAAGGGGGATTTGAG TGG Intergenic
No off target data available for this crispr