ID: 1126205299

View in Genome Browser
Species Human (GRCh38)
Location 15:46038500-46038522
Sequence CTCCCTATGGGGAAAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126205299_1126205306 11 Left 1126205299 15:46038500-46038522 CCACCCATTTTCCCCATAGGGAG No data
Right 1126205306 15:46038534-46038556 TAACTATCTCCACCACTCTGTGG No data
1126205299_1126205307 12 Left 1126205299 15:46038500-46038522 CCACCCATTTTCCCCATAGGGAG No data
Right 1126205307 15:46038535-46038557 AACTATCTCCACCACTCTGTGGG No data
1126205299_1126205310 26 Left 1126205299 15:46038500-46038522 CCACCCATTTTCCCCATAGGGAG No data
Right 1126205310 15:46038549-46038571 CTCTGTGGGTCAAGCCTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126205299 Original CRISPR CTCCCTATGGGGAAAATGGG TGG (reversed) Intergenic
No off target data available for this crispr