ID: 1126206650

View in Genome Browser
Species Human (GRCh38)
Location 15:46053240-46053262
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126206644_1126206650 2 Left 1126206644 15:46053215-46053237 CCTGGCTCAGTGATCAGCTGGGG No data
Right 1126206650 15:46053240-46053262 AAAGCTTCTTGGAGGGATATGGG No data
1126206640_1126206650 29 Left 1126206640 15:46053188-46053210 CCACTGGAGAGGTTGGCTGTGAT No data
Right 1126206650 15:46053240-46053262 AAAGCTTCTTGGAGGGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126206650 Original CRISPR AAAGCTTCTTGGAGGGATAT GGG Intergenic
No off target data available for this crispr