ID: 1126211272

View in Genome Browser
Species Human (GRCh38)
Location 15:46103713-46103735
Sequence CCATTAGGGCATATCCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126211267_1126211272 -6 Left 1126211267 15:46103696-46103718 CCTGTACCTTGGGTGGACCATTA No data
Right 1126211272 15:46103713-46103735 CCATTAGGGCATATCCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126211272 Original CRISPR CCATTAGGGCATATCCTACA AGG Intergenic
No off target data available for this crispr