ID: 1126216826

View in Genome Browser
Species Human (GRCh38)
Location 15:46165016-46165038
Sequence AAATTACTGTCTGTGAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126216822_1126216826 26 Left 1126216822 15:46164967-46164989 CCATAGAAAACAGAGAACAGTTC No data
Right 1126216826 15:46165016-46165038 AAATTACTGTCTGTGAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126216826 Original CRISPR AAATTACTGTCTGTGAAGAT TGG Intergenic
No off target data available for this crispr