ID: 1126217877

View in Genome Browser
Species Human (GRCh38)
Location 15:46177381-46177403
Sequence GTTCTAAGCAGAGGAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126217877_1126217880 -5 Left 1126217877 15:46177381-46177403 CCTTCCTTTCCTCTGCTTAGAAC No data
Right 1126217880 15:46177399-46177421 AGAACTCTGTTTCAGCACCAAGG No data
1126217877_1126217882 17 Left 1126217877 15:46177381-46177403 CCTTCCTTTCCTCTGCTTAGAAC No data
Right 1126217882 15:46177421-46177443 GTCAGTGTAAGTGAGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126217877 Original CRISPR GTTCTAAGCAGAGGAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr