ID: 1126225124

View in Genome Browser
Species Human (GRCh38)
Location 15:46261606-46261628
Sequence CCCCATAAGCAGGTGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126225119_1126225124 -5 Left 1126225119 15:46261588-46261610 CCCAGGGCATTGAGACTGCCCCA No data
Right 1126225124 15:46261606-46261628 CCCCATAAGCAGGTGTGGCCAGG No data
1126225120_1126225124 -6 Left 1126225120 15:46261589-46261611 CCAGGGCATTGAGACTGCCCCAT No data
Right 1126225124 15:46261606-46261628 CCCCATAAGCAGGTGTGGCCAGG No data
1126225118_1126225124 -4 Left 1126225118 15:46261587-46261609 CCCCAGGGCATTGAGACTGCCCC No data
Right 1126225124 15:46261606-46261628 CCCCATAAGCAGGTGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126225124 Original CRISPR CCCCATAAGCAGGTGTGGCC AGG Intergenic
No off target data available for this crispr