ID: 1126228376

View in Genome Browser
Species Human (GRCh38)
Location 15:46296991-46297013
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126228375_1126228376 7 Left 1126228375 15:46296961-46296983 CCTAGGAGATAAGGAGTGAGCAA No data
Right 1126228376 15:46296991-46297013 TTTTGCCAATTCTGCATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126228376 Original CRISPR TTTTGCCAATTCTGCATTTT TGG Intergenic
No off target data available for this crispr