ID: 1126231076

View in Genome Browser
Species Human (GRCh38)
Location 15:46325845-46325867
Sequence CCTTGTCTGCAGGATTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126231076_1126231082 9 Left 1126231076 15:46325845-46325867 CCTTCCAAATCCTGCAGACAAGG No data
Right 1126231082 15:46325877-46325899 AATTCTAAACCATTGTTATACGG No data
1126231076_1126231086 25 Left 1126231076 15:46325845-46325867 CCTTCCAAATCCTGCAGACAAGG No data
Right 1126231086 15:46325893-46325915 TATACGGGTAAGAAAAGTCTGGG No data
1126231076_1126231085 24 Left 1126231076 15:46325845-46325867 CCTTCCAAATCCTGCAGACAAGG No data
Right 1126231085 15:46325892-46325914 TTATACGGGTAAGAAAAGTCTGG No data
1126231076_1126231083 10 Left 1126231076 15:46325845-46325867 CCTTCCAAATCCTGCAGACAAGG No data
Right 1126231083 15:46325878-46325900 ATTCTAAACCATTGTTATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126231076 Original CRISPR CCTTGTCTGCAGGATTTGGA AGG (reversed) Intergenic
No off target data available for this crispr