ID: 1126235050

View in Genome Browser
Species Human (GRCh38)
Location 15:46373856-46373878
Sequence CATGCTGGCAAACTGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126235050_1126235054 18 Left 1126235050 15:46373856-46373878 CCAAACTGCAGTTTGCCAGCATG No data
Right 1126235054 15:46373897-46373919 TAGCTCTCCCAGAAATGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126235050 Original CRISPR CATGCTGGCAAACTGCAGTT TGG (reversed) Intergenic
No off target data available for this crispr