ID: 1126235053

View in Genome Browser
Species Human (GRCh38)
Location 15:46373882-46373904
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126235053_1126235054 -8 Left 1126235053 15:46373882-46373904 CCTGATCAAATGTAATAGCTCTC No data
Right 1126235054 15:46373897-46373919 TAGCTCTCCCAGAAATGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126235053 Original CRISPR GAGAGCTATTACATTTGATC AGG (reversed) Intergenic
No off target data available for this crispr