ID: 1126235834

View in Genome Browser
Species Human (GRCh38)
Location 15:46383106-46383128
Sequence CTTCAATCAGTCATTGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126235834_1126235837 5 Left 1126235834 15:46383106-46383128 CCATGTTCAATGACTGATTGAAG No data
Right 1126235837 15:46383134-46383156 ATATAAAGGCCTCATTATCTGGG No data
1126235834_1126235841 23 Left 1126235834 15:46383106-46383128 CCATGTTCAATGACTGATTGAAG No data
Right 1126235841 15:46383152-46383174 CTGGGCCCAAAGCAGGGTAATGG No data
1126235834_1126235835 -9 Left 1126235834 15:46383106-46383128 CCATGTTCAATGACTGATTGAAG No data
Right 1126235835 15:46383120-46383142 TGATTGAAGTAGAAATATAAAGG No data
1126235834_1126235840 17 Left 1126235834 15:46383106-46383128 CCATGTTCAATGACTGATTGAAG No data
Right 1126235840 15:46383146-46383168 CATTATCTGGGCCCAAAGCAGGG No data
1126235834_1126235836 4 Left 1126235834 15:46383106-46383128 CCATGTTCAATGACTGATTGAAG No data
Right 1126235836 15:46383133-46383155 AATATAAAGGCCTCATTATCTGG No data
1126235834_1126235839 16 Left 1126235834 15:46383106-46383128 CCATGTTCAATGACTGATTGAAG No data
Right 1126235839 15:46383145-46383167 TCATTATCTGGGCCCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126235834 Original CRISPR CTTCAATCAGTCATTGAACA TGG (reversed) Intergenic
No off target data available for this crispr