ID: 1126237346

View in Genome Browser
Species Human (GRCh38)
Location 15:46401430-46401452
Sequence TACGTGTGGGGTCCACAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126237346_1126237350 24 Left 1126237346 15:46401430-46401452 CCATTCTGTGGACCCCACACGTA No data
Right 1126237350 15:46401477-46401499 TAGAAGTACAATCTTTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126237346 Original CRISPR TACGTGTGGGGTCCACAGAA TGG (reversed) Intergenic
No off target data available for this crispr