ID: 1126238095

View in Genome Browser
Species Human (GRCh38)
Location 15:46409111-46409133
Sequence GGATTTCAACATATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126238095_1126238097 -7 Left 1126238095 15:46409111-46409133 CCTTTCTCCATATGTTGAAATCC No data
Right 1126238097 15:46409127-46409149 GAAATCCTCCCCACACATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126238095 Original CRISPR GGATTTCAACATATGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr