ID: 1126238155

View in Genome Browser
Species Human (GRCh38)
Location 15:46409737-46409759
Sequence CTGAAGACCTTGGGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126238155_1126238159 -1 Left 1126238155 15:46409737-46409759 CCTGTGTTTCCCAAGGTCTTCAG No data
Right 1126238159 15:46409759-46409781 GACAGACCTTGCCAACTCCCGGG No data
1126238155_1126238164 28 Left 1126238155 15:46409737-46409759 CCTGTGTTTCCCAAGGTCTTCAG No data
Right 1126238164 15:46409788-46409810 TAGAAAGCGCTGTCCTTCTCAGG No data
1126238155_1126238158 -2 Left 1126238155 15:46409737-46409759 CCTGTGTTTCCCAAGGTCTTCAG No data
Right 1126238158 15:46409758-46409780 AGACAGACCTTGCCAACTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126238155 Original CRISPR CTGAAGACCTTGGGAAACAC AGG (reversed) Intergenic
No off target data available for this crispr